Zkscan14 (NM_023322) Mouse Untagged Clone

CAT#: MC217465

Zkscan14 (untagged) - Mouse zinc finger with KRAB and SCAN domains 14 (Zkscan14), (10ug)

USD 670.00


Availability*
13 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Zkscan14 (NM_023322) Mouse Untagged Clone
Symbol Zkscan14
Synonyms 2310046C23Rik; 2810437E14Rik; Zfp99; Znf394
Vector pCMV6-Entry
Sequence Data
>MC217465 representing NM_023322
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGCAGGCTCTGGGGTCGTCCCGCCACCTCTCGGTGCTGGGCTTTGTACGGTGAAGGTGGAGGAGG
ACTCTCCGGGGAATCAGGAGTCCTCCGGTTCCGGAGATTGGCAGAACCCCGAAACTTCTCGAAAACAATT
CAGGCAGTTGCGCTACCAGGAAGTGGCCGGCCCTGAGGAGGCGCTGAGCCGACTTTGGGAGCTCTGTCGG
AGGTGGCTGAGGCCCGAGCTGCTCTCCAAGGAGCAGATCATGGAGCTGTTGGTGCTGGAGCAATTCCTCA
CCATCCTGCCCCAGGAGCTCCAGGCCTACGTGCGGGACCACAGCCCTGAAAGTGGGGAGGAGGCTGCGGC
CTTGGCGCGGACTCTGCAAAGAGCACTGGATCGGGCCTCTCCGCAGGGTTTTATGACCTTCAAGGATGTG
GCTGAATCTCTGACCTGGGAAGAGTGGGAACAGCTGGCTGCAGCTCGGAAAGGTTTCTGTGAAGAGAGCA
CAAAGGACGCTGGGAGCACAGTTGTGCCTGGCTTGGAAACACGAACTGTGAACACAGATGTGATTCTAAA
GCAGGAAATTTTAAAGGAGGCAGAGCCACAGGCATGGCTACAAGAAGTATCCCAGGGAATGGTCCCAGCA
CTTACCAAATGTGGTGACCCCTCTGAGGACTGGGAAGAAAAGCTGCCAAAAGCTGCTGTACTGCTGCAGC
TCCAGGGTTCTGAAGAGCAAGGACGCACTGCCATCCCGCTTCTCATCGGTGTGTCCAGAGAGGAAAGGGA
CTCTAAAAACAATGAGTCTGAGAACAGTGGCAGTTCTGTCCTTGGTCAGCACATCCAGACAGCAGAAGGA
CTGGGCACCAACAGTCAGTGTGGGGATGACCACAAACAAGGTTTCCATGTGAAATGCCATTCAGTGAAGC
CCCACAGCTCTGTGGACAGTGCTGTAGGGCTTCTTGAGACCCAGAGGCAGTTCCAGGAAGACAAACCTTA
CAAATGTGATAGCTGTGAGAAGGGCTTCAGACAGCGCTCGGACCTCTTCAAACACCAGAGAATCCACACA
GGTGAGAAGCCCTATCAGTGCCAAGAGTGTGGGAAACGCTTTAGTCAGAGCGCTGCCCTCGTTAAGCACC
AGCGGACACACACAGGTGAGAAGCCATATGCATGCCCAGAATGCGGGGAGTGCTTCAGGCAGAGCTCACA
TCTGAGTCGGCATCAGAGAACCCATGCCAGTGAGAAGTACTATAAATGTGAGGAGTGTGGGGAGATCGTT
CATGTTTCCAGCCTGTTCAGACATCAGAGACTACACAGAGGGGAGAGACCATACAAGTGTGGAGACTGTG
AGAAGAGCTTCAGACAGCGCTCAGACCTCTTCAAGCACCAGAGAACCCACACAGGAGAGAAGCCCTATGC
GTGTGTCGTCTGCGGGAGAAGATTCAGTCAGAGCGCCACCCTCATTAAACACCAGAGAACTCACACAGGA
GAAAAACCGTATAAATGTTTTCAATGTGGTGAAAGATTTAGACAGAGTACACACCTTGTCCGACACCAAA
GAATCCATCAAAATTCAGTCTCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_023322
ORF Size 1566 bp
Insert Size 1566
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_023322.2, NP_075811
RefSeq Size 1992
RefSeq ORF 1566
Locus ID 67235
Cytogenetics 5|5 G2
Gene Summary May be involved in transcriptional regulation. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.