Insm1 (NM_016889) Mouse Untagged Clone

CAT#: MC217453

Insm1 (untagged) - Mouse insulinoma-associated 1 (Insm1), (10ug)


  "NM_016889" in other vectors (2)

Reconstitution Protocol

USD 777.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
INSM1 Antibody - middle region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Insm1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Insm1
Synonyms IA-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC217453 representing NM_016889
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCCGCGGGTTTCTGGTGAAGCGCAGCAAGAAGTCCACGCCCGTGTCCTACCGGGTCCGCGGCGGCG
AGGACAGTGACCGGGCGCTGCTGCTGTCACCCGGCTGCGGGGGCGCCCGCGCCGAGCCCCCGGTGCCCAG
CCCCGGGCCGCTGCCGCCACCTCCGCCGCCGGCGCTCGCGGAGCGCGCCCATGCTGCGCTCGCCGCCGCG
CTCGCCTGCGCGCCAGGCCCGCCGCCGCCACCCCCGCCAGGCCCGCGGGCCGCGCACTTCGGCAACCCCG
AGGCTGCGCACCCGGCGCCTCTCTACAGTCCCACGCGGCCGGTGAGCCGCGAGCACGAGAAGCACAAGTA
CTTCGAGCGCAGCTTCAACCTGGGCTCGCCGGTGTCCGCTGAGTCCTTCCCCACGCCCGCCGCGCTGCTC
GCAGGGGGAGGCAGCGGCGCCAACGGCGCTGGCGGCGGCGGCGGCGGCACCTGCGGCGGAGACGCGCTGC
TCTTCGCTCCCGCCGAGCTCAAGATGGGCACTGCGTTCTCCGCCGGCGCCGAGGCGGCCCGGGGTCCTGG
GACCGGTCCTCCACTGTCCCCCGCCGCGGCCCTGCGGCCCCCGGGCAAGCGACCGGCGCCCCCCGCCGCT
GTCGCTACAGAGCCGCCCGCCAAGGCAGCCAAGGCCCCGAGCGCCAAAAAGCCGAAGGCCATCCGCAAGC
TGCACTTCGAGGACGAGGTGACCACGTCGCCGGTTCTGGGGCTCAAGATCAAGGAGGGCCCGGTGGAGGC
GCCGCGGGGTCGCGCGGGGGGCGCGACCCGACCCCTGGGCGAGTTCATCTGCCAGCTGTGCAAGGAGGAG
TACGCTGACCCGTTCGCGCTGGCGCAGCACAAGTGCTCGCGCATCGTGCGCGTGGAGTACCGCTGCCCAG
AGTGCGCCAAGGTCTTCAGCTGCCCGGCCAACCTGGCCTCGCACCGCCGCTGGCACAAACCACGGCCGGT
GCCCGCGGCGGCCCGCGCGCCAGAGCCAGAAGCCGCCACCAGGGCGGAGGCGCGCGAGGCTGCGGGCGGC
GGCAGCAGCGATCGGGACACGCCGAGCCCTGGCGGCGTATCCGAGTCAGGCTCCGAGGACGGGCTCTACG
AGTGCCACCACTGCGCCAAGAAGTTCCGTCGCCAGGCCTATCTGCGCAAGCACCTGCTGGCACATCACCA
GGCGCTGCAGGCCAAAGGCGCGCCCCCGCCCCCGCCGCCGCCGCCACCCCCCGCCGAGGACATCCTGGCT
TTCTACGCGGGGCCCGACGAAAAGGCGCCCCAGGAGGCCTCGGGCGACGGCGAGGCGGCCGGCGTGCTGG
GCCTGAGTGCGACCGCCCAGTGCCACCTGTGCCCAGTGTGCGGGGAGACCTTCCCCAGCAAGGGCGCCCA
GGAGCGCCACCTGCGCCTGCTGCACGCTGCCCAGGTGTTCCCCTGCAAGTACTGCCCGGCCACCTTCTAC
AGCTCCCCGGGCCTGACCCGGCACATCAACAAGTGCCACCCGTCTGAGAATAGACAGGTGATCCTCCTTC
AGGTGCCTGTGCGTCCGGCCTGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_016889
Insert Size 1566 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_016889.3, NP_058585.2
RefSeq Size 3038 bp
RefSeq ORF 1566 bp
Locus ID 53626
UniProt ID Q63ZV0
Cytogenetics 2 G1
Gene Summary Sequence-specific DNA-binding transcriptional regulator that plays a key role in neurogenesis and neuroendocrine cell differentiation during embryonic and/or fetal development. Binds to the consensus sequence 5'-[TG][TC][TC][TT][GA]GGG[CG]A-3' in target promoters. Acts as a transcriptional repressor of NEUROD1 and INS expression via its interaction with cyclin CCND1 in a cell cycle-independent manner. Negatively regulates skeletal muscle-specific gene expression in endocrine cells of the pituitary by inhibiting the Notch signaling pathway. Represses target gene transcription by recruiting chromatin-modifying factors, such as HDAC1, HDAC2, HDAC3, KDM1A and RCOR1 histone deacetylases. Binds to its own promoter, suggesting autoregulation as a self-control feedback mechanism. Competes with histone H3 for the same binding site on the histone demethylase complex formed by KDM1A and RCOR1, and thereby inhibits demethylation of histone H3 at 'Lys-4' (By similarity). Promotes the generation and expansion of neuronal basal progenitor cells in the developing neocortex. Involved in the differentiation of endocrine cells of the developing anterior pituitary gland, of the pancreas and intestine, and of sympatho-adrenal cells in the peripheral nervous system. Promotes cell cycle signaling arrest and inhibition of cellular proliferation.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.