Lonrf2 (NM_001029878) Mouse Untagged Clone

CAT#: MC217382

Lonrf2 (untagged) - Mouse LON peptidase N-terminal domain and ring finger 2 (Lonrf2), (10ug)

USD 660.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Lonrf2 (NM_001029878) Mouse Untagged Clone
Symbol Lonrf2
Synonyms 2900060P06Rik; AI851349
Vector pCMV6-Entry
Sequence Data
>MC217382 representing NM_001029878
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGAACTATGATCAAGCCCTGCAGGATGCTGAAGCAGTTTGTCAGAGGGAACCTCTCCTGACCAAGG
GGCACCATATAAAAGCCCAGATTCTTTCTGGATTGGGAAGACATAGAGAAGTGTTAAAGGAATTTATCTA
CTGCCTTGCTTTAAACCCTGAGTGCAACTCGGCGAAGAAAGAAACACAGAAGGTAATATGTGAGGTGTTC
TTTTCAACTTCAGAAAGTGAGCACCAAACCTCAACATCTTCCACTGAAACTGGACCAGAGGCCCTGTGTG
AAGGCCAGACGAATCCCCAGTATCCTCTGGAAGAAGCAGGCGGTCACGCTAATGCAGACAATCCTAAGAC
TCCATCTGAGAAGTCAGATGCACCCGCGGATATCAACTCTTCGGTTTTATATTTTATTCTGGGCCTCCAC
TGTGAAGAGGATAAAAAGGCTCTGGAAGGCATCGTCCCAGCGGCACCCAGCAGCACCTTGAAGAGGCAGC
TTCCCAGTGATGCCCAGGACGATGAGGAGCTCAAAGCGAATACCCCTGAGAAGATTCCCAAGAAAGATGC
AGACTCCCCACCTCAGAGGAATGCGAGCTCGTTAGAGGAAGAGCCAGAGTTCACAATCGATGCGACTGAC
TTTGAGTGTGCGCTGTGCATGAGGCTGCTCTTTGAACCTGTCACTACACCCTGTGGACATACGTTTTGCC
TCAAATGCCTTGAGCGTTGCCTGGACCACGCCCCTCACTGTCCACTGTGCAAGGACAAGCTTTCTGAGCT
GTTGGCAACCAGAAATTTTAATGTAACTGTTCTGACTGAAGAGCTGATATTCCGATACTTACCAGATGAG
TTATCTGACAGGAAGAGGGTCTATGATGAAGAGATGTCAGAGCTGTCCAATCTGACCAGAGATGTGCCCA
TCTTTGTGTGTGCCATGGCCTTCCCTACGGTTCCTTGCCCTCTCCATGTGTTCGAGCCCCGCTACCGGCT
CATGATAAGGAGATGCATGGAAACTGGCACCAAGCGGTTTGGCATGTGTTTATCCGCGGAGAACGCAGGG
ATTTCAGAGTATGGGTGCATGTTGGAGATAAAGGATGTCAGGACTTTCCCTGATGGAAGCTCTGTTGTGG
ATGCAATTGGGATCAGCCGCTTCAGAGTCCTGAGCCACCGCCACCGAGATGGCTACAACACGGCGGACAT
CGAGTACCTGGAGGACGAGAAGGTGGAAGGTCCAGAGTTTGAAGAACTTACCGCCCTCCATGAGTCTGTT
TACCAGCAGTCTGTGTCCTGGTTTGCTTCACTCCAGGATCACATGAAGAAACAAATTCTTAGCCATTTTG
GGTCGATGCCAGACAGGGAGCCAGAGCCACAGAGCAATTCTAGTGGCCCTGCCTGGTCCTGGTGGATTCT
GGCCGTGTTGCCCTTGGAACGCAAGGCTCAACTGGCCATTCTCGGCATGGCCTCCCTGAAAGAGCGTCTT
CTGGCCATTCGACGAATATTAGTCATCATTACACGTAAGCTGAATAGTCGCCAAGAAATGGCTAACAACA
CACAGAGAGATAATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001029878
ORF Size 1557 bp
Insert Size 1557
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001029878.1, NP_001025049
RefSeq Size 5077
RefSeq ORF 1557
Locus ID 381338
Cytogenetics 1|1 B
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.