Zfp207 (NM_001130169) Mouse Untagged Clone

CAT#: MC216979

Zfp207 (untagged) - Mouse zinc finger protein 207 (Zfp207), transcript variant 1, (10ug)

USD 639.00


Availability*
13 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Zfp207 (NM_001130169) Mouse Untagged Clone
Symbol Zfp207
Synonyms 8430401D15Rik; BuGZ; Zep; Znf207
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC216979 representing NM_001130169
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGTCGCAAGAAGAAGAAGCAGCTCAAGCCGTGGTGCTGGTATTGTAACAGAGATTTTGATGATGAGA
AGATCCTTATACAGCACCAAAAAGCAAAGCATTTTAAATGCCATATTTGTCATAAGAAATTATACACAGG
ACCTGGTTTAGCAATTCATTGCATGCAGGTCCATAAAGAAACCATAGATGCAGTACCAAATGCAATACCT
GGGAGAACAGACATAGAGTTGGAAATATATGGCATGGAAGGTATTCCAGAGAAAGATATGGATGAAAGAC
GGCGACTTCTTGAACAGAAAACACAAGAGAGTCAGAAAAAGAAACAACAAGATGATTCTGATGAATATGA
TGATGATGAATCTGCAGCCTCAACTTCCTTTCAGCCACAGCCTGTTCAACCTCAGCAAGGTTATATCCCA
CCAATGGCTCAGCCAGGACTGCCTCCAGTTCCAGGGGCACCAGGAATGCCTCCAGGCATACCTCCATTGA
TGCCAGGTGTTCCTCCCCTGATGCCAGGCATGCCTCCAGTGATGCCAGGAATGCCGCCTGGATTGCATCA
TCAGAGAAAATACACCCAGTCATTTTGCGGTGAAAACATAATGATGCCAATGGGTGGAATGATGCCACCT
GGACCTGGAATACCACCTCTGATGCCAGGTATGCCACCAGGTATGCCCCCACCTGTTCCACGTCCTGGAA
TTCCTCCAATGACTCAAGCACAGGCTGTTTCAGCACCAGGTATTCTTAATAGACCACCTGCACCAACAGC
AGCAGTACCTGCTCCACAGCCTCCAGTTACTAAGCCTCTTTTCCCCAGTGCTGGACAGATGGGGACACCT
GTAACAAGCTCAAGTACAGCTTCATCCAATTCAGAAAGTCTGTCTGCATCTTCTAAAGCTCTGTTTCCTA
GCACAGCACAAGCTCAGGCAGCTGTCCAAGGACCTGTTGGTACAGATTTTAAGCCCTTAAATAGTACTCC
TGCAGCAACAACTACAGAACCCCCAAAGCCTACATTCCCTGCTTATACACAGTCTACAGCGTCAACCACT
AGTACAACAAACAGTACTGCAGCAAAGCCAGCAGCTTCAATAACAAGTAAGCCTGCTACACTCACAACCA
CCAGTGCAACCAGTAAGTTGATCCATCCAGATGAGGATATATCACTGGAAGAAAGAAGGGCACAGTTACC
TAAATATCAGAGAAATCTTCCTCGACCAGGACAAACTCCAATTGGTAATCCACCAGTTGGACCAATTGGG
GGTATGATGCCACCACAGCCAGGCCTGCCACAGCAGCAGGCAATGCGACCTCCAATGCCACCTCATGGTC
AGTATGGTGGTCATCATCAAGGCATGCCAGGTTATCTTCCTGGCGCTATGCCACCGTATGGACAGGGACC
ACCAATGGTGCCCCCTTACCAAGGTGGGCCTCCTCGACCTCCAATGGGAATGAGACCTCCTGTAATGTCG
CAAGGTGGCCGTTACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001130169
ORF Size 1488 bp
Insert Size 1488
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001130169.1, NP_001123641
RefSeq Size 2376
RefSeq ORF 1488
Locus ID 22680
Cytogenetics 11|11 B5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.