Xiap (NM_009688) Mouse Untagged Clone

CAT#: MC216947

Xiap (untagged) - Mouse X-linked inhibitor of apoptosis (Xiap), (10ug)


  "NM_009688" in other vectors (4)

Reconstitution Protocol

USD 732.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Xiap"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Xiap
Synonyms 1110015C02Rik; A; Aipa; Api3; Bir; Birc4; I; IAP3; IL; ILP-1; MIHA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216947 representing NM_009688
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACTTTTAACAGTTTTGAAGGAACTAGAACTTTTGTACTTGCAGACACCAATAAGGATGAAGAATTTG
TAGAAGAGTTTAATAGATTAAAAACATTTGCTAACTTCCCAAGTAGTAGTCCTGTTTCAGCATCAACATT
GGCGCGAGCTGGGTTTCTTTATACCGGTGAAGGAGACACCGTGCAATGTTTCAGTTGTCATGCGGCAATA
GATAGATGGCAGTATGGAGACTCAGCTGTTGGAAGACACAGGAGAATATCCCCAAATTGCAGATTTATCA
ATGGTTTTTATTTTGAAAATGGTGCTGCACAGTCTACAAATCCTGGTATCCAAAATGGCCAGTACAAATC
TGAAAACTGTGTGGGAAATAGAAATCCTTTTGCCCCTGACAGGCCACCTGAGACTCATGCTGATTATCTC
TTGAGAACTGGACAGGTTGTAGATATTTCAGACACCATATACCCGAGGAACCCTGCCATGTGTAGTGAAG
AAGCCAGATTGAAGTCATTTCAGAACTGGCCGGACTATGCTCATTTAACCCCCAGAGAGTTAGCTAGTGC
TGGCCTCTACTACACAGGGGCTGATGATCAAGTGCAATGCTTTTGTTGTGGGGGAAAACTGAAAAATTGG
GAACCCTGTGATCGTGCCTGGTCAGAACACAGGAGACACTTTCCCAATTGCTTTTTTGTTTTGGGCCGGA
ACGTTAATGTTCGAAGTGAATCTGGTGTGAGTTCTGATAGGAATTTCCCAAATTCAACAAACTCTCCAAG
AAATCCAGCCATGGCAGAATATGAAGCACGGATCGTTACTTTTGGAACATGGACATCCTCAGTTAACAAG
GAGCAGCTTGCAAGAGCTGGATTTTATGCTTTAGGTGAAGGCGATAAAGTGAAGTGCTTTCACTGTGGAG
GAGGGCTCACGGATTGGAAGCCAAGTGAAGACCCTTGGGAACAGCATGCGAAGTGGTACCCAGGGTGCAA
ATACCTATTGGATGAGAAGGGGCAAGAATATATAAATAATATTCATTTAACCCATTCACTTGAGGAATCT
TTGGGAAGAACTGCTGAAAAAACACCATCGCTAACTAAAAAAATCGATGATACCATCTTCCAGAATCCTA
TGGTGCAAGAAGCTATACGAATGGGATTTAGCTTCAAGGACATTAAGAAAACAATGGAAGAAAAAATCCA
AACATCCGGGAGCAGCTATCTATCACTTGAGGTCCTGATTGCAGATCTTGTGAGTGCTCAGAAAGATAAT
ACGGAGGATGAGTCAAGTCAAACTTCATTGCAGAAAGACATTAGTACTGAAGAGCAGCTAAGGCGCCTAC
AAGAGGAGAAGCTTTGCAAAATCTGTATGGATAGAAATATTGCTATCGTTTTTGTTCCTTGTGGACATCT
GGTCACTTGTAAACAGTGTGCAGAAGCAGTTGACAAATGTCCCATGTGCTACACCGTCATTACGTTCAAG
CAAAAAATTTTTATGTCTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009688
Insert Size 1491 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_009688.3, NP_033818.2
RefSeq Size 6566 bp
RefSeq ORF 1491 bp
Locus ID 11798
UniProt ID Q60989
Cytogenetics X A4
Gene Summary The protein encoded by this gene is a member of the inhibitor of apoptosis (IAP) family of proteins. While first identified for its role in blocking apoptosis, this protein modulates many other signaling processes including nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) pathways and inflammatory responses. This protein blocks apoptosis by binding and inhibiting target caspases after they have been activated. Binding occurs to some, but not all, caspases. This protein has several conserved regions, including baculoviral IAP repeat (BIR) motifs and a RING finger E3 ligase domain. In humans, mutations in this gene are linked to immunodeficiency in X-linked lymphoproliferative syndrome type-2 (XLP-2). A pseudogene of this gene is found on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.