Cyp2a12 (NM_133657) Mouse Untagged Clone

CAT#: MC216787

Cyp2a12 (untagged) - Mouse cytochrome P450, family 2, subfamily a, polypeptide 12 (Cyp2a12), (10ug)

USD 629.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cyp2a12 (NM_133657) Mouse Untagged Clone
Symbol Cyp2a12
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC216787 representing NM_133657
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGGGCTCAGGGCTGCTCCTCCTAGCCATTCTGGCCTTCCTGAGTGTGATGGTCTTGGTGTCTGTCT
GGCAGCAGAAAATCAGGGGGAAGTTGCCCCCAGGACCCATTCCTTTGCCTTTCATTGGAAATTACCTGCA
ACTGAATAGAAAAGATGTATACAGCTCCATCACACAGCTCCAAGAGCACTATGGCCCTGTGTTCACCATC
CACCTTGGGCCTCGCCGGGTTGTGGTGCTTTATGGATACGATGCAGTCAAAGAGGCTTTGGTGGACCACG
CTGAGGAGTTCAGTGGACGAGGCGAACAGGCCACCTTTAATACACTCTTCAAAGGCTATGGTGTGGCATT
CAGCAATGGGGAACGAGCCAAACAACTCAGACGCTTCTCTATAGCCACACTGAGAGATTTCGGCATGGGC
AAGCGAGGTGTGGAGGAGCGCATCCAGGAGGAGGCAGGCTGTTTGATCAAGATGTTGCAGGGCACTTGTG
GAGCCCCCATTGACCCCACCATCTACCTGAGCAAAACAGCCTCCAATGTCATTAGCTCCATTGTCTTCGG
CGACCGCTTCAACTATGAGGACAAAGAGTTCCTGTCACTGCTGCAGATGATGGGTCAAGTGAACAAATTT
GCTGCTTCACCCACAGGGCAGCTCTATGACATGTTCCATTCAGTTATGAAGTACCTGCCCGGACCACAGC
AACAGATCATCAAGGATTCTCATAAACTGGAAGACTTCATGATACAGAAAGTGAAGCAGAACCAGAGTAC
CCTGGACCCCAATTCCCCACGAGACTTCATTGACTCCTTTCTCATCCACATGCAAAAGGAGAAATATGTT
AATTCAGAGTTTCACATGAAGAACCTAGTGATGACATCATTGAACCTCTTCTTTGCTGGGTCTGAGACAG
TCAGCTCCACACTACGATATGGCTTCCTGCTACTAATGAAGCATCCAGATGTAGAGGCCAAGGTCCATGA
GGAGATTGACCGAGTGATTGGCAGGAACCGACAGCCCCAATATGAGGACCATATGAAGATGCCCTACACC
CAGGCTGTGATCAATGAGATCCAGAGATTTTCTAACTTTGCTCCCTTGGGCATTCCTCGAAGGATTACCA
AGGATACTTCCTTCCGTGGCTTCTTCCTCCCCAAGGGCACTGAAGTGTTTCCTATACTGGGTTCTCTGAT
GACAGACCCAAAGTTCTTCTCTAGCCCCAAAGACTTCAACCCACAGCACTTCCTGGATGACAAGGGACAG
TTGAAGAAGATCCCTGCTTTTCTGCCCTTTTCCACTGGGAAGCGATTCTGCTTGGGAGACAGCCTGGCTA
AGATGGAGCTGTTCCTGTTCTTCACCACCATCTTGCAGAACTTCCGTTTCAAGTTCCCAAGGAAACTAGA
AGATATCAATGAGTCCCCTACACCAGAGGGGTTTACCAGGATCATACCAAAGTACACCATGAGCTTCGTG
CCCATCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_133657
ORF Size 1479 bp
Insert Size 1479
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_133657.1, NP_598418
RefSeq Size 1675
RefSeq ORF 1479
Locus ID 13085
Cytogenetics 7|7 A3
Gene Summary Highly active in the 7-alpha-hydroxylation of testosterone. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.