Zfp207 (NM_011751) Mouse Untagged Clone

CAT#: MC216135

Zfp207 (untagged) - Mouse zinc finger protein 207 (Zfp207), transcript variant 4, (10ug)


  "NM_011751" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Zfp207"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Zfp207
Synonyms 8430401D15Rik; BuGZ; Zep; Znf207
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216135 representing NM_011751
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGTCGCAAGAAGAAGAAGCAGCTCAAGCCGTGGTGCTGGTATTGTAACAGAGATTTTGATGATGAGA
AGATCCTTATACAGCACCAAAAAGCAAAGCATTTTAAATGCCATATTTGTCATAAGAAATTATACACAGG
ACCTGGTTTAGCAATTCATTGCATGCAGGTCCATAAAGAAACCATAGATGCAGTACCAAATGCAATACCT
GGGAGAACAGACATAGAGTTGGAAATATATGGCATGGAAGGTATTCCAGAGAAAGATATGGATGAAAGAC
GGCGACTTCTTGAACAGAAAACACAAGAGAGTCAGAAAAAGAAACAACAAGATGATTCTGATGAATATGA
TGATGATGAATCTGCAGCCTCAACTTCCTTTCAGCCACAGCCTGTTCAACCTCAGCAAGGTTATATCCCA
CCAATGGCTCAGCCAGGACTGCCTCCAGTTCCAGGGGCACCAGGAATGCCTCCAGGCATACCTCCATTGA
TGCCAGGTGTTCCTCCCCTGATGCCAGGCATGCCTCCAGTGATGCCAGGAATGCCGCCTGGATTGCATCA
TCAGAGAAAATACACCCAGTCATTTTGCGGTGAAAACATAATGATGCCAATGGGTGGAATGATGCCACCT
GGACCTGGAATACCACCTCTGATGCCAGGTATGCCCCCACCTGTTCCACGTCCTGGAATTCCTCCAATGA
CTCAAGCACAGGCTGTTTCAGCACCAGGTATTCTTAATAGACCACCTGCACCAACAGCAGCAGTACCTGC
TCCACAGCCTCCAGTTACTAAGCCTCTTTTCCCCAGTGCTGGACAGGCTCAGGCAGCTGTCCAAGGACCT
GTTGGTACAGATTTTAAGCCCTTAAATAGTACTCCTGCAGCAACAACTACAGAACCCCCAAAGCCTACAT
TCCCTGCTTATACACAGTCTACAGCGTCAACCACTAGTACAACAAACAGTACTGCAGCAAAGCCAGCAGC
TTCAATAACAAGTAAGCCTGCTACACTCACAACCACCAGTGCAACCAGTAAGTTGATCCATCCAGATGAG
GATATATCACTGGAAGAAAGAAGGGCACAGTTACCTAAATATCAGAGAAATCTTCCTCGACCAGGACAAA
CTCCAATTGGTAATCCACCAGTTGGACCAATTGGGGGTATGATGCCACCACAGCCAGGCCTGCCACAGCA
GCAGGCAATGCGACCTCCAATGCCACCTCATGGTCAGTATGGTGGTCATCATCAAGGCATGCCAGGTTAT
CTTCCTGGCGCTATGCCACCGTATGGACAGGGACCACCAATGGTGCCCCCTTACCAAGGTGGGCCTCCTC
GACCTCCAATGGGAATGAGACCTCCTGTAATGTCGCAAGGTGGCCGTTACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011751
Insert Size 1383 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_011751.3, NP_035881.1
RefSeq Size 2271 bp
RefSeq ORF 1383 bp
Locus ID 22680
UniProt ID Q9JMD0
Cytogenetics 11 B5
Gene Summary Kinetochore- and microtubule-binding protein that plays a key role in spindle assembly. ZNF207/BuGZ is mainly composed of disordered low-complexity regions and undergoes phase transition or coacervation to form temperature-dependent liquid droplets. Coacervation promotes microtubule bundling and concentrates tubulin, promoting microtubule polymerization and assembly of spindle and spindle matrix by concentrating its building blocks (PubMed:26388440). Also acts as a regulator of mitotic chromosome alignment by mediating the stability and kinetochore loading of BUB3. Mechanisms by which BUB3 is protected are unclear: according to a first report, ZNF207/BuGZ may act by blocking ubiquitination and proteasomal degradation of BUB3. According to another report, the stabilization is independent of the proteasome (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) uses an alternate in-frame splice site in the mid coding region, and lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. The resulting isoform (4) is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.