Ptk6 (NM_009184) Mouse Untagged Clone

CAT#: MC215963

Ptk6 (untagged) - Mouse PTK6 protein tyrosine kinase 6 (Ptk6), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ptk6
• Synonyms: BRK; Sik; tks; Tksk
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC215963 representing NM_009184
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGTGTCTTGGGACAAGGCTCACCTGGGTCCTAAGTATGTGGGCCTCTGGGACTTCAAGGCACGGACAG
  ATGAGGAGCTGAGCTTTCAGGCAGGAGACCTCCTCCATGTTACCAAGAAGGAGGAACTGTGGTGGTGGGC
  CACCCTGCTGGATGCAGAAGGCAAGGCCTTGGCTGAGGGCTATGTGCCTCACAACTACCTGGCTGAGAAG
  GAAACTGTGGAGTCTGAACCGTGGTTCTTTGGTTGCATCTCCCGCTCAGAGGCCATGCACAGGCTGCAGG
  CTGAGGACAACTCGAAGGGTGCCTTCCTGATCAGAGTCAGCCAGAAGCCAGGAGCAGACTATGTCCTCTC
  TGTCCGGGATGCTCAGGCCGTGCGACATTACAGGATCTGGAAGAACAACGAGGGCCGGCTGCACCTGAAT
  GAGGCGGTATCCTTCTCCAATCTGTCTGAGCTTGTGGACTACCATAAGACCCAGAGCCTGTCTCATGGCC
  TACAGCTGTCCATGCCCTGCTGGAAGCACAAAACTGAGCCCTTGCCCCACTGGGATGACTGGGAGAGGCC
  GAGGGAGGAGTTCACACTCTGTAAGAAGCTGGGGGCCGGCTACTTTGGGGAGGTCTTTGAAGCGCTCTGG
  AAAGGCCAGGTCCATGTGGCTGTGAAGGTGATCTCTAGAGACAATCTCCTGCACCAGCACACCTTCCAGG
  CTGAGATTCAGGCCATGAAGAAGCTGCGGCACAAGCACATCCTGTCACTGTACGCTGTGGCGACTGCAGG
  GGACCCGGTCTACATCATCACGGAGCTCATGCCCAAGGGGAACCTGCTGCAGCTACTGCGTGACTCTGAT
  GAGAAAGCCCTGCCTATTTTGGAGCTGGTGGACTTTGCATCACAGGTTGCTGAGGGCATGTGCTACCTGG
  AATCTCAGAATTACATCCACCGTGACCTGGCTGCAAGGAACGTTCTTGTTACAGAGAACAATCTCTGCAA
  AGTGGGGGACTTTGGGCTTGCCAGGCTTGTCAAGGAGGACATCTACCTTTCCCATGAGCACAATGTCCCC
  TACAAATGGACAGCACCTGAGGCACTTTCCCGAGGGCATTACTCCATCAAGTCTGATGTCTGGTCTTTTG
  GAGTTCTTCTTCATGAAATTTTCAGCAGGGGGCAGATGCCCTACCCAGGCATGTCCAATCATGAAACCTT
  CCTGAGGGTGGATGCCGGCTACCGCATGCCCTGCCCTCTGGAGTGCCCACCCAACATACACAAGCTGATG
  CTCAGCTGCTGGAGCAGAGACCCCAAGCAGAGACCTTGCTTCAAAGACCTGTGTGAGAAACTCACAGGTA
  TCACCAGGTATGAGAACCTGGTCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_009184
• Insert Size: 1356 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_009184.2, NP_033210.1
• RefSeq Size: 2286 bp
• RefSeq ORF: 1356 bp
• Locus ID: 20459
• UniProt ID: Q64434
• Cytogenetics: 2 103.62 cM
• Gene Summary: Non-receptor tyrosine-protein kinase implicated in the regulation of a variety of signaling pathways that control the differentiation and maintenance of normal epithelia, as well as tumor growth. Function seems to be context dependent and differ depending on cell type, as well as its intracellular localization. A number of potential nuclear and cytoplasmic substrates have been identified. These include the RNA-binding proteins: KHDRBS1/SAM68, KHDRBS2/SLM1, KHDRBS3/SLM2 and SFPQ/PSF; transcription factors: STAT3 and STAT5A/B and a variety of signaling molecules: ARHGAP35/p190RhoGAP, PXN/paxillin, BTK/ATK, STAP2/BKS. Associates also with a variety of proteins that are likely upstream of PTK6 in various signaling pathways, or for which PTK6 may play an adapter-like role. These proteins include ADAM15, EGFR, ERBB2, ERBB3 and IRS4. In normal or non-tumorigenic tissues, PTK6 promotes cellular differentiation and apoptosis. In tumors PTK6 contributes to cancer progression by sensitizing cells to mitogenic signals and enhancing proliferation, anchorage-independent survival and migration/invasion. Association with EGFR, ERBB2, ERBB3 may contribute to mammary tumor development and growth through enhancement of EGF-induced signaling via BTK/AKT and PI3 kinase. Contributes to migration and proliferation by contributing to EGF-mediated phosphorylation of ARHGAP35/p190RhoGAP, which promotes association with RASA1/p120RasGAP, inactivating RhoA while activating RAS. EGF stimulation resulted in phosphorylation of PNX/Paxillin by PTK6 and activation of RAC1 via CRK/CrKII, thereby promoting migration and invasion. PTK6 activates STAT3 and STAT5B to promote proliferation. Nuclear PTK6 may be important for regulating growth in normal epithelia, while cytoplasmic PTK6 might activate oncogenic signaling pathways.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.