Efemp2 (NM_021474) Mouse Untagged Clone

CAT#: MC215826

Efemp2 (untagged) - Mouse epidermal growth factor-containing fibulin-like extracellular matrix protein 2 (Efemp2), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Efemp2
• Synonyms: 0610011K11Rik; Fbln4; MBP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC215826 representing NM_021474
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTCCCTTTTGCCTCCTGCCTCCCCGGGTCTTTGCTGCTCTGGGCGTTTCTGCTGTTGCTCTTGGGAG
  CAGCGTCCCCACAGGATCCCGAGGAGCCGGACAGCTACACGGAATGCACAGATGGCTATGAGTGGGATGC
  AGACAGCCAGCACTGCCGGGATGTCAACGAGTGCCTGACCATCCCGGAGGCTTGCAAGGGTGAGATGAAA
  TGCATCAACCACTACGGGGGTTATTTGTGTCTGCCTCGCTCTGCTGCCGTCATCAGTGATCTCCATGGTG
  AAGGACCTCCACCGCCAGCGGCCCATGCTCAACAACCAAACCCTTGCCCGCAGGGCTACGAGCCTGATGA
  ACAGGAGAGCTGTGTGGATGTGGACGAGTGTACCCAGGCTTTGCATGACTGTCGCCCTAGTCAGGACTGC
  CATAACCTTCCTGGCTCCTACCAGTGCACCTGCCCTGATGGTTACCGAAAAATTGGACCCGAATGTGTGG
  ACATAGATGAGTGTCGTTACCGCTATTGCCAGCATCGATGTGTGAACCTGCCGGGCTCTTTTCGATGCCA
  GTGTGAGCCAGGCTTCCAGTTGGGACCTAACAACCGCTCTTGTGTGGATGTGAATGAGTGTGACATGGGA
  GCCCCATGTGAGCAGCGCTGCTTCAACTCCTATGGGACCTTCCTGTGTCGCTGTAACCAGGGCTATGAGC
  TGCACCGGGATGGCTTCTCCTGCAGCGATATCGATGAGTGCGGCTACTCCAGTTACCTCTGCCAGTACCG
  CTGTGTCAACGAGCCAGGCCGATTCTCCTGTCACTGCCCACAAGGCTACCAGCTGCTGGCTACAAGGCTC
  TGCCAAGATATTGACGAGTGTGAAACAGGTGCACACCAATGTTCTGAGGCCCAAACCTGTGTCAACTTCC
  ATGGGGGTTACCGCTGTGTGGACACCAACCGTTGTGTGGAGCCCTATGTCCAAGTGTCAGACAACCGCTG
  CCTCTGCCCTGCCTCCAATCCCCTTTGTCGAGAGCAGCCTTCATCCATTGTGCACCGCTACATGAGCATC
  ACCTCAGAGCGAAGTGTGCCTGCTGACGTGTTTCAGATCCAGGCAACCTCTGTCTACCCTGGTGCCTACA
  ATGCCTTTCAGATCCGTTCTGGAAACACACAGGGGGACTTCTACATTAGGCAAATCAACAATGTCAGCGC
  CATGCTGGTCCTCGCCAGGCCAGTGACGGGACCCCGGGAGTACGTGCTGGACCTGGAGATGGTCACCATG
  AATTCCCTTATGAGCTACCGGGCCAGCTCTGTACTGAGACTCACGGTCTTTGTGGGAGCCTATACCTTCT
  GA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_021474
• Insert Size: 1332 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_021474.3, NP_067449.3
• RefSeq Size: 1561 bp
• RefSeq ORF: 1332 bp
• Locus ID: 58859
• UniProt ID: Q9WVJ9
• Cytogenetics: 19 A
• Gene Summary: Plays a crucial role in elastic fiber formation in tissue, and in the formation of ultrastructural connections between elastic laminae and smooth muscle cells in the aorta, therefore participates in terminal differentiation and maturation of smooth muscle cell (SMC) and in the mechanical properties and wall integrity maintenance of the aorta (PubMed:16478991, PubMed:19855011, PubMed:20019329, PubMed:26486174, PubMed:26711913, PubMed:28508064). In addition, is involved in the control of collagen fibril assembly in tissue throught proteolytic activation of LOX leading to cross- linking of collagen and elastin (PubMed:26690653, PubMed:26711913, PubMed:26220971, PubMed:26178373). Also promotes ELN coacervation and participates in the deposition of ELN coacervates on to microfibrils but also regulates ELN cross- linking through LOX interaction (PubMed:17324935). Moreover adheres to the cells through heparin binding in a calcium-dependent manner and regulates vascularlar smooth muscle cells proliferation through angiotensin signaling (PubMed:23636094).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the more frequently occurring transcript.