Rbm24 (NM_001081425) Mouse Untagged Clone

CAT#: MC215378

Rbm24 (untagged) - Mouse RNA binding motif protein 24 (Rbm24), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rbm24
• Synonyms: 6330546B05Rik; AI606861
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC215378 representing NM_001081425
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCACACCACCCAGAAGGACACGACGTACACCAAGATCTTCGTGGGAGGGCTGCCCTACCACACCACCG
  ACGCCAGCCTGCGCAAGTACTTTGAGGTCTTCGGAGACATCGAGGAAGCGGTGGTCATCACAGACCGGCA
  GACCGGCAAGTCCCGGGGCTACGGATTTGTCACCATGGCTGACAGGGCTGCCGCTGAAAGGGCCTGCAAG
  GATCCCAACCCCATCATCGATGGTAGGAAGGCCAATGTGAATCTGGCATACTTGGGAGCAAAACCAAGAA
  TCATGCAGCCAGGTTTTGCCTTTGGCGTTCAACAGCTTCACCCAGCCCTTATCCAGAGACCTTTCGGGAT
  CCCCGCCCACTACGTCTACCCGCAGGCTTTTGTGCAGCCTGGAGTGGTCATTCCCCATGTGCAGCCCACA
  GCAGCCGCGGCTTCCACCACACCGTACATTGATTACACTGGAGCCGCCTACGCTCAGTACTCCGCTGCCG
  CAGCCGCCGCCGCAGCGGCCGCTGCCTATGACCAGTACCCCTATGCAGCATCCCCAGCTGCTGCAGGCTA
  TGTAACCACTGGGGGCTACAGCTATGCTGTCCAACAGCCCATCACCGCCGCTGCGCCCGGGACAGCTGCT
  GCTGCGGCTGCAGCTGCTGCAGCCGCAGCCGCCTTTGGCCAGTACCAGCCTCAACAGCTGCAGACAGACC
  GAATGCAGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001081425
• Insert Size: 711 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001081425.1, NP_001074894.1
• RefSeq Size: 3224 bp
• RefSeq ORF: 711 bp
• Locus ID: 666794
• UniProt ID: D3Z4I3
• Cytogenetics: 13 A5
• Gene Summary: Multifunctional RNA-binding protein involved in the regulation of pre-mRNA splicing, mRNA stability and mRNA translation important for cell fate decision and differentiation (PubMed:25313962, PubMed:26844700). Plays a major role in pre-mRNA alternative splicing regulation. Mediates preferentially muscle-specific exon inclusion in numerous mRNAs important for striated cardiac and skeletal muscle cell differentiation (PubMed:25313962, PubMed:26844700). Binds to intronic splicing enhancer (ISE) composed of stretches of GU-rich motifs localized in flanking intron of exon that will be included by alternative splicing (PubMed:25313962). Involved in embryonic stem cell (ESC) transition to cardiac cell differentiation by promoting pre-mRNA alternative splicing events of several pluripotency and/or differentiation genes. Plays a role in the regulation of mRNA stability. Binds to 3'-untranslated region (UTR) AU-rich elements in target transcripts, such as CDKN1A and MYOG, leading to maintain their stabilities. Involved in myogenic differentiation by regulating MYOG levels. Binds to multiple regions in the mRNA 3' UTR of TP63, hence inducing its destabilization. Promotes also the destabilization of the CHRM2 mRNA via its binding to a region in the coding sequence. Plays a role in the regulation of mRNA translation. Mediates repression of p53/TP53 mRNA translation through its binding to U-rich element in the 3' UTR, hence preventing EIF4E from binding to p53/TP53 mRNA and translation initiation. Binds to a huge amount of mRNAs (By similarity). Required for embryonic heart development, sarcomer and M-band formation in striated muscles (PubMed:25313962, PubMed:29358667).[UniProtKB/Swiss-Prot Function]