Slc51b (NM_178933) Mouse Untagged Clone

CAT#: MC214598

Slc51b (untagged) - Mouse organic solute transporter beta (Ostb), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Slc51b
• Synonyms: Ostb
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC214598 representing NM_178933
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGACCACAGTGCAGAGAAAGCTGCAGCCAATGCCGAGGTGCCCCAGGAACTGCTGGAAGAAATGCTTT
  GGTATTTTCGTGCAGAAGATGCGGCTCCTTGGAATTATTCCATCCTGGTCCTGGCAGTCCTGGTGGTCAT
  GACAAGCATGTTCCTCCTGAGAAGGAGCATCCTGGCAAACAGAAATCGAAAGAAGCAGCCACAAGACAAA
  GAAACACCAGAAGACCTGCATCTTGATGACTCCATAATGAAAGAGAACAACAGCCAGGTCTTCCTAAGAG
  AGACATTGATCTCAGAGAAACCAGACTTGGCCCCGGGGGAACCTGAGTTGAAAGAGAAAGACTCATCACT
  TGTCTTTCTGCCAGACCCACAGGAAACAGAGAGCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_178933
• Insert Size: 387 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_178933.2, NP_849264.1
• RefSeq Size: 488 bp
• RefSeq ORF: 387 bp
• Locus ID: 330962
• UniProt ID: Q80WK2
• Cytogenetics: 9 C
• Gene Summary: Essential component of the Ost-alpha/Ost-beta complex, a heterodimer that acts as the intestinal basolateral transporter responsible for bile acid export from enterocytes into portal blood. Efficiently transports the major species of bile acids. Modulates SLC51A glycosylation, membrane trafficking and stability activities.[UniProtKB/Swiss-Prot Function]