Fam19a1 (NM_182808) Mouse Untagged Clone
CAT#: MC214451
Fam19a1 (untagged) - Mouse family with sequence similarity 19, member A1 (Fam19a1), (10ug)
"NM_182808" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Fam19a1 |
Synonyms | C630007B19Rik; FAM19A1 TAFA-1; Tafa-1; TAFA1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC214451 representing NM_182808
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAATGGTCTCTGCAATGTCCTGGGCCCTGTACTTGTGGATAAGTGCTTGTGCGATGCTGCTCTGCC ATGGGTCACTCCAACACACCTTCCAGCAGCATCACCTGCACCGGCCAGAAGGAGGGACCTGTGAAGTGAT CGCGGCCCACAGGTGTTGTAACAAGAACCGCATCGAGGAGCGGTCACAAACAGTGAAGTGTTCCTGTTTA CCTGGGAAAGTGGCTGGGACAACAAGAAACCGACCTTCCTGTGTGGATGCCTCCATAGTAATTGGGAAAT GGTGGTGTGAGATGGAGCCCTGCCTAGAAGGAGAAGAATGTAAGACACTCCCTGACAATTCTGGATGGAT GTGTGCTACAGGCAACAAGATTAAGACTACACGAATTCACCCAAGAACCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_182808 |
Insert Size | 402 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_182808.3, NP_877960.1 |
RefSeq Size | 3252 bp |
RefSeq ORF | 402 bp |
Locus ID | 320265 |
UniProt ID | Q7TPG8 |
Cytogenetics | 6 D3 |
Gene Summary | This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines that act as regulators of immune and nervous cells. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG213089 | Fam19a1 (tGFP-tagged) - Mouse family with sequence similarity 19 member A1 (Fam19a1), (10ug) |
USD 350.00 |
|
MR213089 | Fam19a1 (Myc-DDK-tagged) - Mouse family with sequence similarity 19, member A1 (Fam19a1) |
USD 150.00 |
|
MR213089L3 | Lenti ORF clone of Fam19a1 (Myc-DDK-tagged) - Mouse family with sequence similarity 19, member A1 (Fam19a1) |
USD 450.00 |
|
MR213089L4 | Lenti ORF clone of Fam19a1 (mGFP-tagged) - Mouse family with sequence similarity 19, member A1 (Fam19a1) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review