Serpina5 (NM_172953) Mouse Untagged Clone

CAT#: MC214265

Serpina5 (untagged) - Mouse serine (or cysteine) peptidase inhibitor, clade A, member 5 (Serpina5), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Serpina5
• Synonyms: 4933415L04; PAI-3; Pci
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC214265 representing NM_172953
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGGTTCTTCCCCATTCTGTGCCTGGTGCTGTTCATCAGCCATGGGGTGGCTTCCCGCCGACACTCCC
  ATTCCAAGAAGAAGAAGGCTAAAGAGTCCTCGGTGGGTGCTGTGGGACCTCCCAGTAGCAAAGACTTTGC
  TTTCAGACTCTACAGGGCCTTGGTTTCTGAATCCCCTGGTCAGAATGTCTTCTTCTCCCCCTTGAGCGTG
  TCTATGAGTTTGGGCATGCTCTCCCTGGGGGCTGGCTTGAAGACGAAGACCCAGATCCTAGATGGCCTAG
  GCCTCAGCCTCCAGCAAGGCCAAGAAGACAAGCTCCACAAGGGCTTCCAACAGCTGCTACAGAGATTCAG
  GCAGCCTAGTGATGGCCTGCAGCTGAGCCTGGGCAGTGCCCTTTTTAAAGACCCAGCAGTACATATCCGG
  GACGACTTCCTGAGTGCCATGAAGACACTGTACATGTCAGACACTTTCTCTACCAACTTTGGGAACCCTG
  AAATCGCCAAGAAGCAGATCAACAACTATGTAGCCAAGCAGACCAAGGGCAAGATTGTAGACTTTATCAA
  GGATCTTGACAGCACCCATGTCATGATAGTGGTAAATTACATCTTCTTCAAAGCCAAGTGGCAGACGGCC
  TTCAGTGAGACAAACACCCACAAGATGGATTTCCATGTGACCCCCAAAAGGACCACACAGGTGCCCATGA
  TGAACCGTGAAGATGGGTATTCCTACTACCTGGACCAAAACATCTCCTGCACGGTGGTGGGGATCCCTTA
  TCAAGGCAATGCCATCGCTCTATTTATTCTCCCCAGCGAGGGCAAGATGAAGCAGGTGGAGGATGGCCTG
  GATGAGAGAACATTGAGGAACTGGCTTAAGATGTTCACCAAAAGACGCTTAGATCTTTACCTCCCCAAGT
  TCTCCATTGAGGCTACCTACAAACTGGAAAATGTCCTCCCCAAGCTGGGCATCCAGGACGTCTTCACCAC
  CCATGCTGACTTGTCTGGCATTACTGACCATACCAATATCAAGTTGTCTGAGATGGTGCACAAATCCATG
  ATGGAGGTTGAAGAGTCAGGAACCACAGCAGCTGCCATCACAGGAGCCATCTTCACATTCAGATCTGCTC
  GGCCGAGCTCCCTGAAGATAGAATTCACCAGACCCTTTCTGCTGACCCTTATGGAGGATTCACATATACT
  TTTCGTTGGCAAGGTGACCCGGCCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_172953
• Insert Size: 1218 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_172953.3, NP_766541.2
• RefSeq Size: 2162 bp
• RefSeq ORF: 1218 bp
• Locus ID: 268591
• UniProt ID: P70458
• Cytogenetics: 12 E
• Gene Summary: Heparin-dependent serine protease inhibitor acting in body fluids and secretions. Inactivates serine proteases by binding irreversibly to their serine activation site. Involved in the regulation of intravascular and extravascular proteolytic activities. Plays hemostatic roles in the blood plasma. Acts as a procoagulant and proinflammatory factor by inhibiting the anticoagulant activated protein C factor as well as the generation of activated protein C factor by the thrombin/thrombomodulin complex. Acts as an anticoagulant factor by inhibiting blood coagulation factors like prothrombin, factor XI, factor Xa, plasma kallikrein and fibrinolytic enzymes such as tissue- and urinary-type plasminogen activators. In seminal plasma, inactivates several serine proteases implicated in the reproductive system. Inhibits the serpin acrosin; indirectly protects component of the male genital tract from being degraded by excessive released acrosin. Inhibits tissue-and urinary-type plasminogen activator, prostate-specific antigen and kallikrein activities; has a control on the sperm motility and fertilization. Inhibits the activated protein C-catalyzed degradation of SEMG1 and SEMG2; regulates the degradation of semenogelin during the process of transfer of spermatozoa from the male reproductive tract into the female tract. In urine, inhibits urinary-type plasminogen activator and kallikrein activities. Inactivates membrane-anchored serine proteases activities such as MPRSS7 and TMPRSS11E. Inhibits urinary-type plasminogen activator-dependent tumor cell invasion and metastasis. May also play a non-inhibitory role in seminal plasma and urine as a hydrophobic hormone carrier by its binding to retinoic acid (By similarity).[UniProtKB/Swiss-Prot Function]