Dars (NM_145507) Mouse Untagged Clone
CAT#: MC212782
Dars (untagged) - Mouse aspartyl-tRNA synthetase (Dars), transcript variant 2, (10ug)
"NM_145507" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Dars |
Synonyms | 5730439G15Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC212782 representing NM_145507
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCCAGCACCAACGCCAGCCGTAAGGGTCAGGAGAAGCCGCGGGAGATCGTGGACGCGGCGGAAGATT ATGCTAAAGAGAGATATGGGATATCTTCTATGATACAATCACAAGAAAAGCCAGATAGAGTTTTGGTTCG AGTTAAGGACCTGACAGTTCAAAAAGCTGATGATGTTGTTTGGGTCCGTGCAAGAGTTCATACAAGCAGA GCAAAAGACTGGGAACCTACCGACCGTTTGTTCTTTCTCTTTTTTAACTATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_145507 |
Insert Size | 264 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_145507.2, NP_663482.2 |
RefSeq Size | 702 bp |
RefSeq ORF | 264 bp |
Locus ID | 226414 |
Cytogenetics | 1 E3 |
Gene Summary | Catalyzes the specific attachment of an amino acid to its cognate tRNA in a 2 step reaction: the amino acid (AA) is first activated by ATP to form AA-AMP and then transferred to the acceptor end of the tRNA.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 3' UTR and includes an alternate 3' exon, but it lacks several exons in the 3' coding region compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG208055 | Dars (tGFP-tagged) - Mouse aspartyl-tRNA synthetase (Dars) |
USD 713.00 |
|
MG217423 | Dars (tGFP-tagged) - Mouse aspartyl-tRNA synthetase (Dars) transcript variant 2, (10ug) |
USD 350.00 |
|
MR217423 | Dars (Myc-DDK-tagged) - Mouse aspartyl-tRNA synthetase (Dars), transcript variant 2 |
USD 150.00 |
|
MR217423L3 | Lenti ORF clone of Dars (Myc-DDK-tagged) - Mouse aspartyl-tRNA synthetase (Dars), transcript variant 2 |
USD 450.00 |
|
MR217423L4 | Lenti ORF clone of Dars (mGFP-tagged) - Mouse aspartyl-tRNA synthetase (Dars), transcript variant 2 |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review