Ubxn1 (NM_146093) Mouse Untagged Clone

CAT#: MC212768

Ubxn1 (untagged) - Mouse UBX domain protein 1 (Ubxn1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ubxn1
• Synonyms: 2B28; 4930455J02Rik; D19Ertd721e; T25529
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212768 representing NM_146093
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGGAGCTGACGGCTCTGGAGAGCCTCATCGAGATGGGCTTTCCCAGGGGACGCGCGGAGAAGGCTC
  TGGCCCTCACAGGGAACCAGGGCATCGAGGCTGCGATGGATTGGCTGATGGAGCATGAAGACGACCCCGA
  TGTGGATGAGCCTCTGGAGACTCCCCTCAGCCATGTCCTGGGACGAGAACCCACGCCCTCAGAGCAAGTT
  GGCCCTGAAGGCTCTGGGTCTGCTGCTGGAGAAAGCAGACCCATTTTGACTGAAGAGGAGAGACAAGAAC
  AGACCAAGAGAATGTTGGAACTTGTGGCACAAAAGCAGCGGGAACGTGAAGAAAGAGAGGAGCGAGAAGC
  TTTAGAACGAGAAAAGCAGCGGAGGAGACAAGGGCAAGAGCTGTCAGTTGCACGACAGAAACTGCAGGAA
  GATGAGATGCGCCGGGCTGCGGAGGAGCGCAGGAGGGAAAAGGCTGAAGAGTTAGCTGCCAGACAAAGGG
  TTCGAGAAAAAATTGAAAGGGACAAAGCAGAGAGAGCCAAGAAGTATGGTGGTAGTGTGGGTTCTCGGTC
  ATCCCCACCAGCAACAGACCCAGGTCCTGTTCCTTCTTCTCCCAGCCAGGAGCCCCCTACTAAGCGGGAG
  TATGACCAGTGTCGTATACAGGTTAGGCTGCCTGATGGGACTTCACTGACCCAGACTTTCCGGGCCCGGG
  AACAGCTGGCAGCTGTGAGGCTCTACGTGGAGCTTCACCGTGGGGAGGAGCCTGGACAGGACCAGGACCC
  TGTGCAGTTGCTCAGTGGCTTCCCCAGACGGGCTTTCTCAGAGGCTGATATGGAACGGCCTCTGCAGGAA
  CTGGGACTCGTGCCTTCTGCTGTCCTCATTGTGGCCAAGAAGTGTCCCAGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_146093
• Insert Size: 894 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_146093.1, NP_666205.1
• RefSeq Size: 1048 bp
• RefSeq ORF: 894 bp
• Locus ID: 225896
• UniProt ID: Q922Y1
• Cytogenetics: 19 A
• Gene Summary: Ubiquitin-binding protein that plays a role in the modulation of innate immune response. Blocks both the RIG-I-like receptors (RLR) and NF-kappa-B pathways. Following viral infection, UBXN1 is induced and recruited to the RLR component MAVS. In turn, interferes with MAVS oligomerization, and disrupts the MAVS/TRAF3/TRAF6 signalosome. This function probably serves as a brake to prevent excessive RLR signaling. Interferes with the TNFalpha-triggered NF-kappa-B pathway by interacting with cellular inhibitors of apoptosis proteins (cIAPs) and thereby inhibiting their recruitment to TNFR1. Prevents also the activation of NF-kappa-B by associating with CUL1 and thus inhibiting NF-kappa-B inhibitor alpha/NFKBIA degradation that remains bound to NF-kappa-B. Interacts with the BRCA1-BARD1 heterodimer and regulates its activity. Specifically binds 'Lys-6'-linked polyubiquitin chains. Interaction with autoubiquitinated BRCA1 leads to the inhibition of the E3 ubiquitin-protein ligase activity of the BRCA1-BARD1 heterodimer. Component of a complex required to couple deglycosylation and proteasome-mediated degradation of misfolded proteins in the endoplasmic reticulum that are retrotranslocated in the cytosol.[UniProtKB/Swiss-Prot Function]