Eif4e1b (NM_001039683) Mouse Untagged Clone
CAT#: MC212683
Eif4e1b (untagged) - Mouse eukaryotic translation initiation factor 4E family member 1B (Eif4e1b), transcript variant 2, (10ug)
"NM_001039683" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Eif4e1b |
Synonyms | Eif4eloo; Gm273 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC212683 representing NM_001039683
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAACAAAGTTGAGGGTGGAGGGCATAAGGAGGAGGTGGTGGTGAAAGAAAAGGAGGTAGTGAAAGAAA AGCCATCAGAAGCAACTGCGGAGGGAGTCCAAGCAGGAGAAGCCAAAGACCTTCCTGGCTCCCTTAAGAC TCAGAGGAGGAAGGCCCACAGAGAACATCCACCAGAGGTCCTGAGCAAGCTACACCCCTTGCAGTACAGG TGGGTTCTGTGGTTCTTCAAGAATGACCGAAGCCGGGCCTGGCAGGACAACCTGCAGCTAGTCACCAAGT TTAACACTGTGGAGGACTTCTGGGCGGTGTACAGCCATATCAAGCTGGCCAGCAAGCTCTCTTCCGGCTG TGACTATGCCCTGTTCAAGGAAGGCATCCTGCCCATGTGGGAAGACAACAGAAACAAGCAGGGTGGCCGC TGGCTGCTCAGCATTGACAAACAACTGCGCCACTTCGAACTGGACCGTCTGTGGCTGGAGACGCAGGGAA GTGTGCGGTGCTGTCGTGAACATCCGCACGAAGAGGGACAAGATTGCCCTGTGGACGAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001039683 |
Insert Size | 552 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001039683.2, NP_001034772.1 |
RefSeq Size | 1881 bp |
RefSeq ORF | 552 bp |
Locus ID | 218268 |
UniProt ID | Q3UTA9 |
Cytogenetics | 13 B1 |
Gene Summary | Recognizes and binds the 7-methylguanosine-containing mRNA cap during an early step in the initiation of protein synthesis and facilitates ribosome binding by inducing the unwinding of the mRNAs secondary structures.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift and early stop codon, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG220441 | Eif4e1b (tGFP-tagged) - Mouse eukaryotic translation initiation factor 4E family member 1B (Eif4e1b) transcript variant 2, (10ug) |
USD 530.00 |
|
MR220441 | Eif4e1b (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 4E family member 1B (Eif4e1b), transcript variant 2 |
USD 330.00 |
|
MR220441L3 | Lenti ORF clone of Eif4e1b (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 4E family member 1B (Eif4e1b), transcript variant 2 |
USD 630.00 |
|
MR220441L4 | Lenti ORF clone of Eif4e1b (mGFP-tagged) - Mouse eukaryotic translation initiation factor 4E family member 1B (Eif4e1b), transcript variant 2 |
USD 630.00 |
{0} Product Review(s)
Be the first one to submit a review