Tnfrsf13c (NM_028075) Mouse Untagged Clone
CAT#: MC211278
Tnfrsf13c (untagged) - Mouse tumor necrosis factor receptor superfamily, member 13c (Tnfrsf13c), (10ug)
"NM_028075" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Tnfrsf13c |
Synonyms | 2010006P15Rik; BAFF-R; Baffr; Bcmd; Bcmd-1; Bcmd1; Lvis22 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211278 representing NM_028075
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCGCCAGGAGACTCCGGGTCCGAAGCCAGAGGAGCCGGGACAGCTCGGTGCCCACCCAGTGCAATC AGACCGAGTGCTTCGACCCTCTGGTGAGAAACTGCGTGTCCTGTGAGCTCTTCCACACGCCGGACACTGG ACATACAAGCAGCCTGGAGCCTGGGACAGCTCTGCAGCCTCAGGAGGGCTCCGCGCTGAGACCCGACGTG GCGCTGCTCGTCGGTGCCCCCGCACTCCTGGGACTGATACTGGCGCTGACCCTGGTGGGTCTAGTGAGTC TGGTGAGCTGGAGGTGGCGTCAACAGCTCAGGACGGCCTCCCCAGACACTTCAGAAGGAGTCCAGCAAGA GTCCCTGGAAAATGTCTTTGTACCCTCCTCAGAAACCCCTCATGCCTCAGCTCCTACCTGGCCTCCGCTC AAAGAAGATGCAGACAGCGCCCTGCCACGCCACAGCGTCCCGGTGCCCGCCACAGAACTGGGCTCCACCG AGCTGGTGACCACCAAGACAGCTGGCCCAGAGCAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_028075 |
Insert Size | 528 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC104127, AAI04128 |
RefSeq Size | 971 bp |
RefSeq ORF | 528 bp |
Locus ID | 72049 |
UniProt ID | Q9D8D0 |
Cytogenetics | 15 E1 |
Gene Summary | B-cell receptor specific for TNFSF13B/TALL1/BAFF/BLyS. Promotes the survival of mature B-cells and the B-cell response.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226524 | Tnfrsf13c (tGFP-tagged) - Mouse tumor necrosis factor receptor superfamily member 13c (Tnfrsf13c), (10ug) |
USD 650.00 |
|
MR226524 | Tnfrsf13c (Myc-DDK-tagged) - Mouse tumor necrosis factor receptor superfamily, member 13c (Tnfrsf13c) |
USD 450.00 |
|
MR226524L3 | Lenti ORF clone of Tnfrsf13c (Myc-DDK-tagged) - Mouse tumor necrosis factor receptor superfamily, member 13c (Tnfrsf13c) |
USD 750.00 |
|
MR226524L4 | Lenti ORF clone of Tnfrsf13c (mGFP-tagged) - Mouse tumor necrosis factor receptor superfamily, member 13c (Tnfrsf13c) |
USD 750.00 |
{0} Product Review(s)
Be the first one to submit a review