Spdya (NM_001142631) Mouse Untagged Clone

CAT#: MC211112

Spdya (untagged) - Mouse speedy homolog A (Xenopus laevis) (Spdya), transcript variant 2, (10ug)


  "NM_001142631" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Spdya"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Spdya
Synonyms 4921517J08Rik; 4930548B21Rik; GS4; MLZ-465; Spdy1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211112 representing NM_001142631
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGGCATAATCAGATGTATTGTGAGACACCACCTACTGTCACTATTCATGTAAAATCAGGCTCAAATA
GGTCACATCAAACCAGAAAACCTATTAGTCTGAAACGTCCTATTCTTAAAGATAGTTGGGAAGCATCTGA
AAACAATGCTCAGAATAACAAATCTAAGCGGCCCAGAGGGCCTTGTCTAATCATACAGCGCCAGGAAATG
ACTGCTTTCTTTAAATTATTTGATGATGATTTAATTCAAGATTTCTTGTGGATGGACTGCTGCTGCAAGA
TTGCAGACAAGTATCTTTTGGCTATGACCTTTGTTTATTTCAAGAGAGCTAAATTTACTATAAATGAGCA
TACCAGGATAAATTTCTTTATTGCTCTGTATCTGGCTAATACGGTTGAAGAAGATGAAGAAGAAGCCAAG
TATGAAATTTTTCCATGGGCTTTAGGGAAAAACTGGAGAAAACTGTTCCCTAATTTCTTAAAGTTAAGGG
ACCAACTCTGGGACAGAATTGACTATAGGGCTATTGTAAGCAGGCGATGCTGTGAAGAGGTCATGGCCAT
TGCGCCAACCCATTACATCTGGCAACGAGAGCGGTCTGTGCATCACAGTGGAGCTGTTAGGAACTACAAC
AGAGATGAGGTTCACCTGCCCAGGGGACCTAGTGCCACACCAGTGGATTGCTCACTGTGTGGTAAAAAAG
GAAGATACGTGAGACTGGGACTGTCTTCATCCTCATCTTCCTCCAGTGACACAGGAGAGCTAATGGAAAA
AGATTCTCAGGAACTACACAGTGCATTCTCAGTGGACACGGCAGGTGACCCTCCTCATACCTATTCTCAA
GGTATGGCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001142631
Insert Size 852 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001142631.1, NP_001136103.1
RefSeq Size 1247 bp
RefSeq ORF 852 bp
Locus ID 70891
UniProt ID Q5IBH7
Cytogenetics 17 E1.3
Gene Summary Regulates the G1/S phase transition of the cell cycle by binding and activating CDK1 and CDK2 (PubMed:15611625). Contributes to CDK2 activation without promoting CDK2 phosphorylation, by inducing a conformation change of the CDK2 T-loop that obstructs the substrate-binding cleft prior to kinase activation. Interferes with CDKN1B-mediated inhibition of CDK2. Mediates cell survival during the DNA damage process through activation of CDK2 (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses a different splice site in the 3' coding region, compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus when it is compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.