Spink2 (NM_183284) Mouse Untagged Clone
CAT#: MC211021
Spink2 (untagged) - Mouse serine peptidase inhibitor, Kazal type 2 (Spink2), (10ug)
"NM_183284" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Spink2 |
Synonyms | 1700007F22Rik; AV038945; HUSI-II |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211021 representing NM_183284
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGAGACTGGTGCTGTTGCTCCTGGTCACAGACTTTGCAGCCTCTCATGAGACTCTCGACTCTTCCG ATTCTCAAATCATGAAGAGGTCACAGTTCCGAACACCAGACTGTGGTCATTTTGACTTCCCAGCATGCCC TAGGAACCTCAACCCTGTGTGCGGAACGGATATGAACACTTACAGCAATGAATGTACCCTGTGCATGAAA ATCAGGGAGGACGGTAGCCATATTAATATCATCAAAGACGAGCCATGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_183284 |
Insert Size | 261 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_183284.3, NP_899107.1 |
RefSeq Size | 631 bp |
RefSeq ORF | 261 bp |
Locus ID | 69982 |
UniProt ID | Q8BMY7 |
Cytogenetics | 5 C3.3 |
Gene Summary | As a strong inhibitor of acrosin, it is required for normal spermiogenesis. It probably hinders premature activation of proacrosin and other proteases, thus preventing the cascade of events leading to spermiogenesis defects (PubMed:21705336, PubMed:28554943). May be involved in the regulation of serine protease-dependent germ cell apoptosis (PubMed:21705336). It also inhibits trypsin (PubMed:21705336).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains an alternate 5' terminal exon and initiates translation at an alternate start codon, compared to variant 1. It encodes isoform 2, which is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200191 | Spink2 (tGFP-tagged) - Mouse serine peptidase inhibitor, Kazal type 2 (Spink2) |
USD 350.00 |
|
MR200191 | Spink2 (Myc-DDK-tagged) - Mouse serine peptidase inhibitor, Kazal type 2 (Spink2) |
USD 150.00 |
|
MR200191L3 | Lenti ORF clone of Spink2 (Myc-DDK-tagged) - Mouse serine peptidase inhibitor, Kazal type 2 (Spink2) |
USD 450.00 |
|
MR200191L4 | Lenti ORF clone of Spink2 (mGFP-tagged) - Mouse serine peptidase inhibitor, Kazal type 2 (Spink2) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review