Cntnap2 (NM_025771) Mouse Untagged Clone
CAT#: MC210438
Cntnap2 (untagged) - Mouse contactin associated protein-like 2 (Cntnap2), transcript variant 2, (10ug)
"NM_025771" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cntnap2 |
Synonyms | 5430425M22Rik; Caspr2; mKIAA0868 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210438 representing NM_025771
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTTCAGCCACTGACCCTTGGCACCTAGATCACTTGGATTCAGCCAGTGCTGATTTCCCATATAACC CAGGACAAGGCCAAGCTATAAGAAATGGAGTCAACAGAAACTCAGCTATCATTGGAGGGGTCATCGCTGT GGTGATTTTCACCATCCTCTGCACCCTGGTCTTCCTCATCCGGTACATGTTCCGTCACAAGGGCACCTAC CACACCAATGAGGCCAAGGGAGCTGAGTCAGCCGAGAGTGCAGATGCTGCCATCATGAACAACGACCCCA ACTTCACAGAGACCATTGACGAGAGCAAAAAGGAGTGGCTCATTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_025771 |
Insert Size | 327 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_025771.3, NP_080047.1 |
RefSeq Size | 3449 bp |
RefSeq ORF | 327 bp |
Locus ID | 66797 |
UniProt ID | Q9CPW0 |
Cytogenetics | 6 B2.2- B2.3 |
Gene Summary | Required, with CNTNAP1, for radial and longitudinal organization of myelinated axons (PubMed:25378149). Plays a role in the formation of functional distinct domains critical for saltatory conduction of nerve impulses in myelinated nerve fibers. Demarcates the juxtaparanodal region of the axo-glial junction (Probable) (PubMed:25378149).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG221931 | Cntnap2 (tGFP-tagged) - Mouse contactin associated protein-like 2 (Cntnap2) transcript variant 2, (10ug) |
USD 425.00 |
|
MR221931 | Cntnap2 (Myc-DDK-tagged) - Mouse contactin associated protein-like 2 (Cntnap2), transcript variant 2 |
USD 225.00 |
|
MR221931L3 | Lenti ORF clone of Cntnap2 (Myc-DDK-tagged) - Mouse contactin associated protein-like 2 (Cntnap2), transcript variant 2 |
USD 525.00 |
|
MR221931L4 | Lenti ORF clone of Cntnap2 (mGFP-tagged) - Mouse contactin associated protein-like 2 (Cntnap2), transcript variant 2 |
USD 525.00 |
{0} Product Review(s)
Be the first one to submit a review