Bud23 (NM_025375) Mouse Untagged Clone

CAT#: MC210281

Wbscr22 (untagged) - Mouse Williams Beuren syndrome chromosome region 22 (Wbscr22), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Bud23
• Synonyms: 1110003N24Rik; Wbscr22
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210281 representing NM_025375
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCATCTCGTAGCCGGAGACCCGAACACAGCGGACCGCCGGAGCTGTTTTATGACCAGAATGAAGCCC
  GGAAATACGTTCGCAACTCACGGATGATTGACATCCAGACCAAGATGACTGAGCGAGCGCTGGAGCTCCT
  CTGTTTACCAGAGGGTCAGCCTTCTTACCTGTTAGACATTGGCTGCGGTTCTGGGCTGAGTGGAGATTAT
  ATCTCAGAAGAGGGACACTACTGGGTGGGCATTGACATCAGCCCTGCCATGTTGGATGCCGCCTTGGACC
  GAGATACAGAGGGGGACCTGCTGCTAGGGGACATGGGCCAGGGCGTCCCTTTCAGACCGGGCTCTTTTGA
  TGGCTGCATCAGCATCTCTGCTGTGCAGTGGCTCTGCAACGCCAACAAGAAGTCGGACGTCCCTGCCAGG
  CGCCTGTACTGCTTCTTTTCTTCCTTGTACTCTGCCCTTGTCCGTGGGGCCCGAGCTGTCCTGCAGCTGT
  ACCCTGAGAACTCGGAGCAGCTGGAGCTGATCACAACCCAGGCCACGAGGGCAGGCTTCACTGGCGGCGT
  GGTGGTAGACTTCCCCAACAGTGCCAAAGCAAAGAAGTTCTACCTCTGTCTGTTTTCTGGGCCTTCCACC
  TCCCTGCCAAAGGGGCTGACTGAAAGTCAGGATGCAGACCAGGCCTCCGAGTCCATGTTCACCAGTGAGC
  GGGCCCCACACAAGAAGGCACGGAGGGACCTGGTGAAGAAGAGCCGGGAATGGGTCCTAGAGAAGAAGGA
  GAGGCGCAGGCGCCAGGGCAAGGAGGTCAGACCTGACACCCAGTACACCGGCCGAAAGCGCAAGCCCCGC
  TTCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_025375
• Insert Size: 846 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_025375.3, NP_079651.2
• RefSeq Size: 1531 bp
• RefSeq ORF: 846 bp
• Locus ID: 66138
• UniProt ID: Q9CY21
• Cytogenetics: 5 G2
• Gene Summary: S-adenosyl-L-methionine-dependent methyltransferase that specifically methylates the N(7) position of a guanine in 18S rRNA. Requires the methyltransferase adapter protein TRM112 for full rRNA methyltransferase activity. Involved in the pre-rRNA processing steps leading to small-subunit rRNA production independently of its RNA-modifying catalytic activity. Important for biogenesis end export of the 40S ribosomal subunit independent on its methyltransferase activity. Locus-specific steroid receptor coactivator. Potentiates transactivation by glucocorticoid (NR3C1), mineralocorticoid (NR3C2), androgen (AR) and progesterone (PGR) receptors. Required for the maintenance of open chromatin at the TSC22D3/GILZ locus to facilitate NR3C1 loading on the response elements. Required for maintenance of dimethylation on histone H3 'Lys-79' (H3K79me2), although direct histone methyltransferase activity is not observed in vitro.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.