Sarnp (NM_025364) Mouse Untagged Clone

CAT#: MC210277

Sarnp (untagged) - Mouse SAP domain containing ribonucleoprotein (Sarnp), (10ug)


  "NM_025364" in other vectors (4)

Reconstitution Protocol

USD 330.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Sarnp"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Sarnp
Synonyms 1110005A23Rik; Cip29
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210277 representing NM_025364
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCCGAGACGGTGGAGCTCCACAAGCTGAAGCTTGCTGAACTAAAGCAAGAATGTCTTGCTCGTG
GTTTAGAGACCAAGGGAATAAAACAAGATCTTATAAATAGGCTGCAGGCCTATCTTGAAGACCATGCAGA
AGAAGAAGCAAATGAAGAAGATGTACTGGGAGATGAAACTGAGGAAGAAGAACCAAAGCCCATAGAACTG
CCTGTTAAAGAGGAAGAACCTCCTGAAAAGGCTGTTGATATGGCATCGGAAAAGAAGGTGGTAAAGATTA
CATCTGGGATACCTCAGACTGAAAGAATGCAGAAGAGGGCTGAACGATTCAATGTACCTGTAAGCCTGGA
GAGTAAGAAGGCTGCCCGGGCGGCTAGGTTTGGAATTTCTTCAGTTCCAACAAAAGGTTTATCATCTGAC
ACCAAGCCTATGGTTAACCTGGATAAACTAAAGGAAAGAGCACAGAGATTTGGTTTGAATGTCTCTTCCA
TCTCTAGAAAGTCTGAGGATGATGAGAAGCTGAAGAAACGGAAGGAGAGATTTGGGATTGTGACAAGTTC
AGCTGGAACTGGAACCACAGAGGATACAGAGGCAAAGAAAAGAAAAAGAGCAGAGCGTTTTGGAATTGCA
TAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_025364
Insert Size 633 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_025364.2, NP_079640.1
RefSeq Size 1064 bp
RefSeq ORF 633 bp
Locus ID 66118
UniProt ID Q9D1J3
Cytogenetics 10 D3
Gene Summary Binds both single-stranded and double-stranded DNA with higher affinity for the single-stranded form. Specifically binds to scaffold/matrix attachment region DNA. Also binds single-stranded RNA. Enhances RNA unwinding activity of DDX39A. May participate in important transcriptional or translational control of cell growth, metabolism and carcinogenesis. Component of the TREX complex which is thought to couple mRNA transcription, processing and nuclear export, and specifically associates with spliced mRNA and not with unspliced pre-mRNA. TREX is recruited to spliced mRNAs by a transcription-independent mechanism, binds to mRNA upstream of the exon-junction complex (EJC) and is recruited in a splicing- and cap-dependent manner to a region near the 5' end of the mRNA where it functions in mRNA export to the cytoplasm via the TAP/NFX1 pathway (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.