Ctdsp2 (NM_001113470) Mouse Untagged Clone

CAT#: MC209895

Ctdsp2 (untagged) - Mouse CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 (Ctdsp2), transcript variant a, (10ug)


  "NM_001113470" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Ctdsp2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ctdsp2
Synonyms AI586070; D10Ertd73e; OS-4; OS4; SCP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209895 representing NM_001113470
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAACACGGCTCCATCATCACCCAGGCGCGGAGGGAAGACGCCCTGGTGCTCACCAAGCAAGGCCTAG
TCTCCAAGTCCTCGCCTAAGAAACCCCGTGGCCGCAGCATCTTCAAGGCCCTCTTGTGCTGTTTCCACAC
ACAGCATGTTGTCCAGTCCAGCTCTTCCACTGAGCTCACACACAAGGAGGAGGCCAACACCATCGCCAAG
TCCGATCTCCTCCAGTGTCTCCAGTACCAGTTTTATCAGATCCCTGGGACCTGCCTGCTCCCCGAGGTGA
CAGAGCAAGATCAAGGCAGGATCTGCGTGGTCATTGACCTGGATGAGACCCTTGTGCACAGTTCCTTTAA
GCCGATCAACAATGCTGACTTCATAGTGCCTGTAGAGATTGAGGGGACCACGCACCAGGTATATGTGCTC
AAGAGGCCTTACGTCGATGAGTTCCTGAGACGGATGGGGGAGCTCTTCGAATGTGTTCTCTTCACTGCCA
GCTTGGCCAAGTATGCTGACCCTGTGACTGATCTCCTGGACCGGTGCGGGGTGTTCCGGGCCCGCCTGTT
CCGAGAGGCTTGTGTGTTCCACCAGGGCTGCTATGTCAAGGACCTCAGCCGCCTGGGAAGGGACCTGAGG
AAAACTGTCATCCTGGACAACTCCCCTGCATCTTACATCTTCCACCCAGAAAATGCAGTGCCTGTGCAGT
CCTGGTTTGATGACATGGCAGATACAGAGTTGCTGAACCTGATTCCAGTCTTCGAGGAGCTAAGTGGAAC
TGATGATGTCTACACCAGCCTTGGGCAGCTGCGGGCCCCTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001113470
Insert Size 813 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001113470.1, NP_001106941.1
RefSeq Size 4823 bp
RefSeq ORF 813 bp
Locus ID 52468
UniProt ID Q8BX07
Cytogenetics 10 74.35 cM
Gene Summary Preferentially catalyzes the dephosphorylation of 'Ser-5' within the tandem 7 residue repeats in the C-terminal domain (CTD) of the largest RNA polymerase II subunit POLR2A. Negatively regulates RNA polymerase II transcription, possibly by controlling the transition from initiation/capping to processive transcript elongation. Recruited by REST to neuronal genes that contain RE-1 elements, leading to neuronal gene silencing in non-neuronal cells (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (a) represents the longer transcript and encodes the longer isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.