Mapk14 (NM_001168514) Mouse Untagged Clone

CAT#: MC209722

Mapk14 (untagged) - Mouse mitogen-activated protein kinase 14 (Mapk14), transcript variant 4, (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Mapk14 (NM_001168514) Mouse Untagged Clone
Symbol Mapk14
Synonyms Crk1; Csbp1; CSBP2; Mxi2; p38; p38-alpha; p38a; p38alpha; p38MAPK; PRKM14; PRKM15
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC209722 representing NM_001168514
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAACACGAAAATGTGATTGGTCTGTTGGATGTGTTCACACCCGCAAGGTCACTGGAGGAATTCAATG
ACGTGTACCTGGTGACCCATCTCATGGGGGCGGACCTGAACAACATCGTGAAGTGCCAGAAGCTGACCGA
CGACCACGTTCAGTTTCTCATCTACCAGATCCTCCGAGGGCTGAAGTATATACATTCGGCTGACATAATT
CACAGGGACCTAAAGCCCAGCAACCTAGCTGTGAACGAAGACTGTGAGCTCAAGATTCTGGATTTTGGGC
TGGCTCGGCACACTGATGATGAGATGACAGGCTACGTGGCTACCAGGTGGTACCGAGCCCCAGAGATCAT
GCTGAATTGGATGCACTATAACCAGACAGTGGATATTTGGTCCGTGGGCTGCATCATGGCTGAGCTGTTG
ACCGGAAGAACGTTGTTTCCTGGTACAGACCATATTGATCAGTTGAAGCTCATTTTAAGACTCGTTGGAA
CCCCAGGGGCTGAGCTTCTGAAGAAAATCTCCTCAGAGTCTGCAAGAAACTACATTCAGTCTCTGGCCCA
GATGCCGAAGATGAACTTCGCAAATGTATTTATTGGTGCCAATCCCCTGGCTGTCGACCTACTGGAGAAG
ATGCTCGTTTTGGACTCAGATAAGAGGATCACAGCAGCCCAAGCTCTTGCGCATGCCTACTTTGCTCAGT
ACCACGACCCTGATGATGAGCCTGTTGCTGACCCTTATGACCAGTCCTTTGAAAGCAGGGACCTTCTCAT
AGATGAGTGGAAGAGCCTGACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAA
ATGGAGTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001168514
ORF Size 852 bp
Insert Size 852
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001168514.1, NP_001161986
RefSeq Size 3605
RefSeq ORF 852
Locus ID 26416
Cytogenetics 17 A3.3|17 14.85 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.