Zfand5 (NM_009551) Mouse Untagged Clone

CAT#: MC209663

Zfand5 (untagged) - Mouse zinc finger, AN1-type domain 5 (Zfand5), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Zfand5
• Synonyms: 2310057A04Rik; 5830475F03Rik; AA415485; Za20d2; Zfp216
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209663 representing NM_009551
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTCAGGAGACTAACCAGACCCCAGGGCCCATGCTGTGTAGTACAGGATGTGGCTTTTATGGGAATC
  CTAGGACAAATGGAATGTGTTCTGTTTGCTACAAAGAACATCTTCAGAGACAGCAGAATAGTGGCAGAAT
  GAGCCCAATGGGGACAGCTAGTGGTTCCAACAGTCCTACCTCAGATTCTGCATCTGTACAGAGAGCAGAT
  GCTGGTTTAAACAACTGTGAAGGTGCTGCTGGCAGCACATCTGAAAAATCAAGAAATGTGCCTGTGGCTG
  CCTTGCCTGTAACTCAACAAATGACAGAAATGAGCATTTCAAGAGAGGACAAAATAACTACCCCGAAAAC
  AGAGGTGTCAGAGCCAGTTGTCACTCAGCCCAGTCCATCAGTTTCTCAGCCCAGTTCTTCTCAAAGTGAA
  GAAAAAGCTCCTGAGTTGCCCAAACCAAAGAAGAACAGATGTTTTATGTGTAGAAAGAAAGTTGGCCTTA
  CAGGGTTTGACTGCCGATGTGGAAATTTGTTTTGTGGACTTCACCGTTACTCTGACAAGCACAACTGTCC
  ATATGATTACAAAGCAGAAGCTGCAGCAAAAATCAGAAAAGAAAATCCAGTTGTTGTGGCTGAAAAAATC
  CAGAGAATATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_009551
• Insert Size: 642 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_009551.5, NP_033577.1
• RefSeq Size: 7385 bp
• RefSeq ORF: 642 bp
• Locus ID: 22682
• UniProt ID: O88878
• Cytogenetics: 19 14.32 cM
• Gene Summary: Involved in protein degradation via the ubiquitin-proteasome system. May act by anchoring ubiquitinated proteins to the proteasome. Plays a role in ubiquitin-mediated protein degradation during muscle atrophy. Plays a role in the regulation of NF-kappa-B activation and apoptosis. Inhibits NF-kappa-B activation triggered by overexpression of RIPK1 and TRAF6 but not of RELA. Inhibits also tumor necrosis factor (TNF), IL-1 and TLR4-induced NF-kappa-B activation in a dose-dependent manner. Overexpression sensitizes cells to TNF-induced apoptosis. Is a potent inhibitory factor for osteoclast differentiation.[UniProtKB/Swiss-Prot Function]