Tyms (NM_021288) Mouse Untagged Clone

CAT#: MC209604

Tyms (untagged) - Mouse thymidylate synthase (Tyms), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tyms
• Synonyms: T; Ts
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209604 representing NM_021288
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCTGGTGGTTGGCTCCGAGCTGCAGTCCGATGCTCAGCAGCTGAGCGCGGAAGCCCCACGGCATGGAG
  AACTCCAGTACCTGAGGCAGGTGGAGCACATTTTGCGCTGCGGCTTCAAGAAGGAGGACCGCACGGGCAC
  TGGCACCCTGTCGGTGTTCGGCATGCAGGCACGATACAGCCTGAGAGATGAATTTCCTCTGCTCACAACC
  AAACGAGTGTTCTGGAAGGGTGTTTTGGAGGAGTTGTTGTGGTTTATCAAGGGATCCACAAATGCTAAAG
  AATTGTCCTCAAAGGGAGTGAGAATCTGGGATGCCAATGGATCCCGAGATTTTCTGGACAGCTTGGGATT
  TTCTGCCCGACAGGAAGGGGACCTGGGCCCAGTTTATGGTTTCCAATGGAGGCATTTTGGAGCAGAGTAC
  AAAGATATGGATTCAGATTACTCGGGACAAGGAGTAGACCAGCTGCAAAAAGTGATTGACACCATCAAAA
  CCAACCCTGATGACAGAAGAATCATCATGTGTGCCTGGAACCCAAAAGATCTTCCCCTGATGGCACTGCC
  TCCTTGCCATGCCCTCTGTCAGTTCTATGTGGTGAATGGGGAACTGTCTTGCCAGCTTTACCAGAGGTCA
  GGAGATATGGGTCTGGGCGTGCCCTTCAACATTGCCAGCTATGCTCTGCTCACCTACATGATTGCACATA
  TCACAGGCCTGCAGCCAGGTGATTTTGTCCACACTTTGGGAGATGCACATATTTACCTGAATCATATAGA
  GCCGCTGAAAATTCAGCTACAGCGAGAACCAAGACCTTTCCCAAAGCTCAAAATCCTTCGAAAAGTTGAG
  ACAATCGATGATTTCAAAGTTGAAGACTTTCAGATTGAAGGGTATAATCCACATCCAACGATTAAAATGG
  AAATGGCTGTTTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_021288
• Insert Size: 924 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_021288.4, NP_067263.1
• RefSeq Size: 3798 bp
• RefSeq ORF: 924 bp
• Locus ID: 22171
• UniProt ID: P07607
• Cytogenetics: 5 15.81 cM
• Gene Summary: This gene encodes an enzyme that catalyzes the methylation of deoxyuridylate to deoxythymidylate using 5,10-methylenetetrahydrofolate as a cofactor. This function maintains the thymidine-5-prime monophosphate concentration critical for DNA replication and repair. The encoded enzyme is a target for cancer chemotherapeutic agents. The majority of transcripts for this gene lack a 3' UTR (PMID: 3022294, 3444407). The stop codon in these transcripts is UAA, compared to the UAG found in the genome and longer transcripts, as the polyA site is located within the stop codon (PMID: 3444407, 2157203). A related pseudogene has been identified on chromosome 10. [provided by RefSeq, Mar 2010]
  Transcript Variant: This variant (1) represents the shorter transcript and encodes the functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.