Tnfsf4 (NM_009452) Mouse Untagged Clone
CAT#: MC209603
Tnfsf4 (untagged) - Mouse tumor necrosis factor (ligand) superfamily, member 4 (Tnfsf4), (10ug)
"NM_009452" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Tnfsf4 |
Synonyms | Ath-1; Ath1; CD134L; gp34; OX-40L; Ox40l; Tnlg2b; TXGP1; Txgp1l |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209603 representing NM_009452
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_009452 |
Insert Size | 597 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_009452.2, NP_033478.1 |
RefSeq Size | 1609 bp |
RefSeq ORF | 597 bp |
Locus ID | 22164 |
UniProt ID | P43488 |
Cytogenetics | 1 69.75 cM |
Gene Summary | Cytokine that binds to TNFRSF4. Co-stimulates T-cell proliferation and cytokine production.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223452 | Tnfsf4 (tGFP-tagged) - Mouse tumor necrosis factor (ligand) superfamily member 4 (Tnfsf4), (10ug) |
USD 650.00 |
|
MR223452 | Tnfsf4 (Myc-DDK-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 4 (Tnfsf4) |
USD 450.00 |
|
MR223452L1 | Lenti ORF clone of Tnfsf4 (Myc-DDK-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 4 (Tnfsf4) |
USD 750.00 |
|
MR223452L2 | Lenti ORF clone of Tnfsf4 (mGFP-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 4 (Tnfsf4) |
USD 750.00 |
|
MR223452L3 | Lenti ORF clone of Tnfsf4 (Myc-DDK-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 4 (Tnfsf4) |
USD 750.00 |
|
MR223452L4 | Lenti ORF clone of Tnfsf4 (mGFP-tagged) - Mouse tumor necrosis factor (ligand) superfamily, member 4 (Tnfsf4) |
USD 750.00 |
{0} Product Review(s)
Be the first one to submit a review