Tnfrsf18 (NM_021985) Mouse Untagged Clone
CAT#: MC209541
Tnfrsf18 (untagged) - Mouse tumor necrosis factor receptor superfamily, member 18 (Tnfrsf18), transcript variant 2, (10ug)
"NM_021985" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Tnfrsf18 |
Synonyms | AITR; Gitr |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209541 representing NM_021985
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGGCATGGGCCATGCTGTATGGAGTCTCGATGCTCTGTGTGCTGGACCTAGGTCAGCCGAGTGTAG TTGAGGAGCCTGGCTGTGGCCCTGGCAAGGTTCAGAACGGAAGTGGCAACAACACTCGCTGCTGCAGCCT GTATGCTCCAGGCAAGGAGGACTGTCCAAAAGAAAGGTGCATATGTGTCACACCTGAGTACCACTGTGGA GACCCTCAGTGCAAGATCTGCAAGCACTACCCCTGCCAACCAGGCCAGAGGGTGGAGTCTCAAGGGGATA TTGTGTTTGGCTTCCGGTGTGTTGCCTGTGCCATGGGCACCTTCTCCGCAGGTCGTGACGGTCACTGCAG ACTTTGGACCAAAGACCCAGCCATTCGCGGAGGTGCAGTTGTCAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_021985 |
Insert Size | 399 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_021985.2, NP_068820.1 |
RefSeq Size | 817 bp |
RefSeq ORF | 399 bp |
Locus ID | 21936 |
UniProt ID | O35714 |
Cytogenetics | 4 E2 |
Gene Summary | Receptor for TNFSF18. Seems to be involved in interactions between activated T-lymphocytes and endothelial cells and in the regulation of T-cell receptor-mediated cell death. Mediated NF-kappa-B activation via the TRAF2/NIK pathway (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226360 | Tnfrsf18 (tGFP-tagged) - Mouse tumor necrosis factor receptor superfamily member 18 (Tnfrsf18) transcript variant 2, (10ug) |
USD 350.00 |
|
MR226360 | Tnfrsf18 (Myc-DDK-tagged) - Mouse tumor necrosis factor receptor superfamily, member 18 (Tnfrsf18), transcript variant 2 |
USD 150.00 |
|
MR226360L3 | Lenti ORF clone of Tnfrsf18 (Myc-DDK-tagged) - Mouse tumor necrosis factor receptor superfamily, member 18 (Tnfrsf18), transcript variant 2 |
USD 450.00 |
|
MR226360L4 | Lenti ORF clone of Tnfrsf18 (mGFP-tagged) - Mouse tumor necrosis factor receptor superfamily, member 18 (Tnfrsf18), transcript variant 2 |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review