Tank (NM_001164071) Mouse Untagged Clone

CAT#: MC209495

Tank (untagged) - Mouse TRAF family member-associated Nf-kappa B activator (Tank), transcript variant 1, (10ug)


  "NM_001164071" in other vectors (4)

Reconstitution Protocol

USD 503.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Tank"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tank
Synonyms C86182; E430026L09Rik; I-TRAF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209495 representing NM_001164071
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATAAAAACATTGGTGAGCAACTCAATAGAGCATATGAAGCCTTCCGACAGGCATGCATGGATAGAG
ATTCAGCAGTAAGAGAGCTACAGCAAAAGCAGACTGAGAACTATGAACAAAGAATACGCGAGCAACAGGA
ACAGCTGTCATTTCAACAAAACCTAATTGACAGGCTGAAATCACAGCTACTTCTCGTGGATTCTAGTCGA
GATAACAGTTATGGCTATGTACCTTTGCTTGAAGACAGTGACAGAAGGAAGAATAATTTGACCCTTGATG
AACCACATGATAAAGTGAAACTAGGAACACTGAGAGATAAGCAATCAAAGGTGAGACGACAAGAAGTTTC
TTCTGGAAAAGAATCCGCCAAGGGTCTCAACATCCCTCTGCATCACGAAAGGGATAATATAGAGAAGACT
TTCTGGGACCTTAAAGAAGAATTTCATAGGATTTGCTTGCTAGCAAAAGCACAGAAAGATCACTTAAGCA
AACTTAATATACCAGATATTGCAACTGACACACAGTGTTCTGTGCCTATACAGTGTACTGATAAAACAGA
GAAACAAGAAGCGCTGTTTAAGCCCCAGGCTAAAGATGATATAAATAGAGGTATGTCGTGCGTCACAGCT
GTCACACCAAGAGGACTGGGCCGGGATGAGGAAGATACCTCTTTTGAATCACTTTCTAAATTCAATGTCA
AGTTTCCGCCTATGGACAATGACTCTATTTTTCTACATAGCACTCCAGAGGCCCCGAGCATCCTTGCTCC
TGCCACACCTGAGACAGTGTGCCAGGACCGATTTAATATGGAAGTCAGAGACAACCCAGGAAACTTTGTT
AAAACAGAAGAAACTTTATTTGAAATTCAGGGAATTGACCCCATAACTTCAGCTATACAAAACCTTAAAA
CAACTGACAAAACAAACCCCTCAAATCTTAGAGCGACGTGTTTGCCAGCTGGAGACCACAATGTGTTCTA
TGTAAATACGTTCCCACTTCAAGACCCGCCTGACGCACCTTTTCCCTCACTGGATTCCCCAGGAAAGGCT
GTCCGAGGACCACAGCAGCCCTTTTGGAAGCCTTTTCTTAACCAAGACACTGACTTAGTGGTACCAAGTG
ATTCAGACTCAGAGCTCCTTAAACCTCTAGTGTGTGAATTCTGTCAAGAGCTTTTCCCACCATCCATTAC
ATCCAGAGGGGATTTCCTCCGGCATCTTAATACACACTTTAATGGGGAGACTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001164071
Insert Size 1245 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001164071.1, NP_001157543.1
RefSeq Size 2227 bp
RefSeq ORF 1245 bp
Locus ID 21353
Cytogenetics 2 C1.3
Gene Summary Adapter protein involved in I-kappa-B-kinase (IKK) regulation which constitutively binds TBK1 and IKBKE playing a role in antiviral innate immunity. Acts as a regulator of TRAF function by maintaining them in a latent state. Blocks TRAF2 binding to LMP1 and inhibits LMP1-mediated NF-kappa-B activation. Negatively regulates NF-kappaB signaling and cell survival upon DNA damage. Plays a role as an adapter to assemble ZC3H12A, USP10 in a deubiquitination complex which plays a negative feedback response to attenuate NF-kappaB activation through the deubiquitination of IKBKG or TRAF6 in response to interleukin-1-beta (IL1B) stimulation or upon DNA damage. Promotes UBP10-induced deubiquitination of TRAF6 in response to DNA damage. May control negatively TRAF2-mediated NF-kappa-B activation signaled by CD40, TNFR1 and TNFR2. Essential for the efficient induction of IRF-dependent transcription following infection with Sendai virus.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes isoform 1. Variants 1 and 4 both encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.