Supt4a (NM_009296) Mouse Untagged Clone

CAT#: MC209480

Supt4a (untagged) - Mouse suppressor of Ty 4 homolog 1 (S. cerevisiae) (Supt4h1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Supt4a
• Synonyms: AL022777; Supt4h; Supt4h1; Supt4h1a
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209480 representing NM_009296
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCCTGGAGACGGTACCAAAGGACCTGCGGCATCTGCGGGCTTGTTTGCTGTGCTCGTTAGTCAAGA
  CTATAGACCAGTTCGAATATGATGGGTGTGACAATTGCGATGCATACCTACAAATGAAGGGCAACAGAGA
  GATGGTTTATGACTGCACCAGCTCTTCATTTGATGGAATCATTGCGATGATGAGTCCAGAGGACAGCTGG
  GTCTCCAAGTGGCAGCGAGTCAGTAACTTTAAGCCAGGTGTATATGCTGTGTCCGTCACTGGTCGCCTGC
  CCCAAGGAATCGTGCGGGAGCTGAAAAGTCGAGGAGTGGCCTACAAATCCAGAGACACAGCAATAAAGAC
  CTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_009296
• Insert Size: 354 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_009296.1, NP_033322.1
• RefSeq Size: 693 bp
• RefSeq ORF: 354 bp
• Locus ID: 20922
• UniProt ID: P63271
• Cytogenetics: 11 52.2 cM
• Gene Summary: Component of the DRB sensitivity-inducing factor complex (DSIF complex), which regulates mRNA processing and transcription elongation by RNA polymerase II. DSIF positively regulates mRNA capping by stimulating the mRNA guanylyltransferase activity of RNGTT/CAP1A. DSIF also acts cooperatively with the negative elongation factor complex (NELF complex) to enhance transcriptional pausing at sites proximal to the promoter. Transcriptional pausing may facilitate the assembly of an elongation competent RNA polymerase II complex. DSIF and NELF promote pausing by inhibition of the transcription elongation factor TFIIS/S-II. TFIIS/S-II binds to RNA polymerase II at transcription pause sites and stimulates the weak intrinsic nuclease activity of the enzyme. Cleavage of blocked transcripts by RNA polymerase II promotes the resumption of transcription from the new 3' terminus and may allow repeated attempts at transcription through natural pause sites (By similarity).[UniProtKB/Swiss-Prot Function]