Supt4a (NM_009296) Mouse Untagged Clone
CAT#: MC209480
Supt4a (untagged) - Mouse suppressor of Ty 4 homolog 1 (S. cerevisiae) (Supt4h1), (10ug)
"NM_009296" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Supt4a |
Synonyms | AL022777; Supt4h; Supt4h1; Supt4h1a |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209480 representing NM_009296
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCCTGGAGACGGTACCAAAGGACCTGCGGCATCTGCGGGCTTGTTTGCTGTGCTCGTTAGTCAAGA CTATAGACCAGTTCGAATATGATGGGTGTGACAATTGCGATGCATACCTACAAATGAAGGGCAACAGAGA GATGGTTTATGACTGCACCAGCTCTTCATTTGATGGAATCATTGCGATGATGAGTCCAGAGGACAGCTGG GTCTCCAAGTGGCAGCGAGTCAGTAACTTTAAGCCAGGTGTATATGCTGTGTCCGTCACTGGTCGCCTGC CCCAAGGAATCGTGCGGGAGCTGAAAAGTCGAGGAGTGGCCTACAAATCCAGAGACACAGCAATAAAGAC CTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_009296 |
Insert Size | 354 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_009296.1, NP_033322.1 |
RefSeq Size | 693 bp |
RefSeq ORF | 354 bp |
Locus ID | 20922 |
UniProt ID | P63271 |
Cytogenetics | 11 52.2 cM |
Gene Summary | Component of the DRB sensitivity-inducing factor complex (DSIF complex), which regulates mRNA processing and transcription elongation by RNA polymerase II. DSIF positively regulates mRNA capping by stimulating the mRNA guanylyltransferase activity of RNGTT/CAP1A. DSIF also acts cooperatively with the negative elongation factor complex (NELF complex) to enhance transcriptional pausing at sites proximal to the promoter. Transcriptional pausing may facilitate the assembly of an elongation competent RNA polymerase II complex. DSIF and NELF promote pausing by inhibition of the transcription elongation factor TFIIS/S-II. TFIIS/S-II binds to RNA polymerase II at transcription pause sites and stimulates the weak intrinsic nuclease activity of the enzyme. Cleavage of blocked transcripts by RNA polymerase II promotes the resumption of transcription from the new 3' terminus and may allow repeated attempts at transcription through natural pause sites (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200506 | Supt4a (tGFP-tagged) - Mouse suppressor of Ty 4 homolog 1 (S. cerevisiae) (Supt4h1) |
USD 350.00 |
|
MR200506 | Supt4a (Myc-DDK-tagged) - Mouse suppressor of Ty 4 homolog 1 (S. cerevisiae) (Supt4h1) |
USD 150.00 |
|
MR200506L3 | Lenti ORF clone of Supt4a (Myc-DDK-tagged) - Mouse suppressor of Ty 4 homolog 1 (S. cerevisiae) (Supt4h1) |
USD 450.00 |
|
MR200506L4 | Lenti ORF clone of Supt4a (mGFP-tagged) - Mouse suppressor of Ty 4 homolog 1 (S. cerevisiae) (Supt4h1) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review