Bex1 (NM_009052) Mouse Untagged Clone

CAT#: MC209314

Bex1 (untagged) - Mouse brain expressed gene 1 (Bex1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Bex1
• Synonyms: AA407839; AU018692; Bex4; Rex3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209314 representing NM_009052
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGTCCAAAGATCAAGGCGTGAAAAATCTCAACATGGAGAATGACCATCAGAAAAAGGAGGAGAAGG
  AAGAAAAGCCACAAGATACCATCAGAAGGGAGCCAGCTGTGGCCCTGACCTCCGAGGCTGGCAAAAACTG
  TGCACCTAGAGGAGGTCGCAGGCGGTTCCGGGTTCGGCAGCCCATCGCTCACTATAGATGGGACCTGATG
  CAGAGGGTTGGGGAGCCCCAGGGAAGGATGAGAGAGGAGAACGTACAGAGGTTTGGGGGTGATGTGAGAC
  AGCTCATGGAGAAGCTGAGGGAAAGGCAGCTGAGCCACAGCCTGCGGGCGGTTAGCACTGACCCGCCTCA
  TCATGACCACCATGATGAGTTTTGCCTCATGCCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_009052
• Insert Size: 387 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_009052.2, NP_033078.2
• RefSeq Size: 890 bp
• RefSeq ORF: 387 bp
• Locus ID: 19716
• UniProt ID: Q9R224
• Cytogenetics: X 57.4 cM
• Gene Summary: Signaling adapter molecule involved in p75NTR/NGFR signaling. Plays a role in cell cycle progression and neuronal differentiation. Inhibits neuronal differentiation in response to nerve growth factor (NGF). May act as a link between the cell cycle and neurotrophic factor signaling, possibly by functioning as an upstream modulator of receptor signaling, coordinating biological responses to external signals with internal cellular states (By similarity).[UniProtKB/Swiss-Prot Function]