Psme3 (NM_011192) Mouse Untagged Clone

CAT#: MC209247

Psme3 (untagged) - Mouse proteaseome (prosome, macropain) 28 subunit, 3 (Psme3), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Psme3
• Synonyms: AA410043; AU020960; Ki; pa28g; PA28gamma; REGgamma
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC209247 representing NM_011192
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCTCGTTGCTGAAGGTGGATCAGGAAGTGAAGCTCAAGGTTGATTCTTTCAGAGAGCGGATCACAA
  GTGAGGCAGAAGACTTGGTGGCAAATTTTTTCCCAAAGAAGTTACTAGAACTTGATAGTTTTTTGAAGGA
  ACCAATTCTAAATATCCATGACCTAACTCAGATCCACTCAGACATGAACCTCCCAGTCCCTGACCCCATT
  CTCCTCACCAATAGCCACGATGGACTGGATGGTCCCACTTACAAGAAGCGCAGGTTGGATGAATGTGAAG
  AGGCCTTTCAAGGAACCAAGGTGTTTGTGATGCCCAATGGGATGTTGAAAAGCAACCAGCAGCTTGTGGA
  CATTATTGAGAAAGTAAAACCCGAGATTCGGCTGCTGATCGAGAAATGTAACACGGTCAAAATGTGGGTT
  CAGCTGTTGATTCCCAGAATAGAAGATGGGAACAACTTCGGGGTATCAATTCAGGAGGAAACAGTTGCTG
  AACTAAGAACTGTGGAGAGTGAAGCCGCATCTTACCTGGACCAGATTTCTAGATATTATATTACAAGAGC
  CAAATTGGTTTCTAAAATAGCTAAATATCCCCATGTGGAGGACTATCGCCGCACTGTCACAGAGATTGAT
  GAGAAAGAATACATCAGCCTCCGGCTCATCATCTCAGAGCTGAGGAATCAGTATGTCACTCTCCATGACA
  TGATCCTGAAAAACATTGAGAAGATCAAACGGCCCCGGAGCAGCAATGCAGAGACACTGTACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_011192
• Insert Size: 765 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_011192.3, NP_035322.1
• RefSeq Size: 2620 bp
• RefSeq ORF: 765 bp
• Locus ID: 19192
• UniProt ID: P61290
• Cytogenetics: 11 64.67 cM
• Gene Summary: Subunit of the 11S REG-gamma (also called PA28-gamma) proteasome regulator, a doughnut-shaped homoheptamer which associates with the proteasome. 11S REG-gamma activates the trypsin-like catalytic subunit of the proteasome but inhibits the chymotrypsin-like and postglutamyl-preferring (PGPH) subunits. Facilitates the MDM2-p53/TP53 interaction which promotes ubiquitination- and MDM2-dependent proteasomal degradation of p53/TP53, limiting its accumulation and resulting in inhibited apoptosis after DNA damage. May also be involved in cell cycle regulation. Mediates CCAR2 and CHEK2-dependent SIRT1 inhibition (By similarity).[UniProtKB/Swiss-Prot Function]