Gnal (NM_010307) Mouse Untagged Clone

CAT#: MC208564

Gnal (untagged) - Mouse guanine nucleotide binding protein, alpha stimulating, olfactory type (Gnal), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Gnal
• Synonyms: 2610011C15Rik; 9630020G10Rik; Galphaolf; Gna10; Golf
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208564 representing NM_010307
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGGTGTTTGGGCAACAGCAGCAAGACCGCGGAAGATCAGGGCGTAGATGAAAAAGAACGCCGCGAGG
  CCAACAAAAAGATCGAGAAGCAGTTGCAGAAAGAGCGCCTGGCTTACAAAGCAACTCACCGCCTGCTGCT
  TCTGGGGGCTGGTGAGTCCGGGAAAAGCACTATCGTCAAACAGATGAGGATCCTGCACGTCAATGGCTTC
  AACCCCGAGGAAAAGAAGCAGAAAATTCTGGACATCAGGAAAAATGTCAAAGATGCGATCGTGACAATCG
  TTTCAGCAATGAGTACTATCATACCTCCAGTTCCACTGGCCAACCCTGAGAACCAGTTCCGGTCAGATTA
  TATCAAGAGCATAGCCCCTATCACTGACTTTGAATATTCCCAGGAGTTCTTTGACCATGTGAAGAAGCTG
  TGGGACGATGAAGGAGTGAAGGCCTGCTTTGAGAGATCCAACGAGTACCAGCTGATCGACTGTGCACAAT
  ACTTCCTGGAAAGGATTGACAGTGTCAGTCTGGTTGACTACACACCCACAGACCAGGACCTGCTCAGATG
  CAGAGTGCTGACATCAGGAATCTTTGAGACACGATTCCAAGTGGACAAAGTGAACTTTCACATGTTTGAT
  GTTGGAGGCCAGAGAGATGAGAGAAGAAAATGGATCCAGTGTTTTAATGATGTCACTGCGATCATTTACG
  TGGCGGCCTGTAGTAGCTACAACATGGTGATCCGGGAAGATAACAATACCAACAGACTTCGGGAATCACT
  GGACCTGTTTGAAAGCATCTGGAATAACAGGTGGTTGCGAACCATTTCTATCATCCTATTCTTGAACAAA
  CAAGACATGCTGGCAGAAAAAGTCTTGGCAGGGAAGTCAAAAATCGAAGACTATTTCCCGGAGTATGCCA
  ATTATACTGTCCCTGAAGATGCAACACCAGATGCGGGAGAAGATCCCAAAGTTACAAGAGCAAAGTTCTT
  TATCCGGGATCTGTTCTTGAGGATCAGCACAGCCACGGGTGATGGCAAACATTACTGCTACCCTCACTTC
  ACCTGCGCCGTGGACACAGAGAACATCCGCAGAGTGTTCAACGATTGCCGTGACATCATCCAGAGAATGC
  ATCTCAAGCAGTACGAACTCTTGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010307
• Insert Size: 1146 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_010307.2, NP_034437.1
• RefSeq Size: 5489 bp
• RefSeq ORF: 1146 bp
• Locus ID: 14680
• UniProt ID: Q8CGK7
• Cytogenetics: 18 39.85 cM
• Gene Summary: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems. G(olf) alpha mediates signal transduction within the olfactory neuroepithelium and the basal ganglia. May be involved in some aspect of visual transduction, and in mediating the effect of one or more hormones/neurotransmitters (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the use of an alternate promoter, differs in the 5' UTR and initiates translation at an alternate start codon compared to variant 2. The encoded protein (isoform 1) has a distinct N-terminus and is shorter than isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.