Cox5b (NM_009942) Mouse Untagged Clone

CAT#: MC208309

Cox5b (untagged) - Mouse cytochrome c oxidase, subunit Vb (Cox5b), nuclear gene encoding mitochondrial protein, (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cox5b (NM_009942) Mouse Untagged Clone
Symbol Cox5b
Synonyms MGC117683
Vector pCMV6-Entry
Sequence Data
>MC208309 representing NM_009942
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTTCAAGGTTACTTCGCGGAGTGGGCGCTTTGGCGGCGCAGGCCCTGAGGGCCCACGGCCCCCGTG
GCGCGGCCGTGACCCGCTCCATGGCTTCTGGAGGTGGTGTCCCCACTGATGAGGAGCAGGCTACTGGGCT
GGAGAGGGAGATCATGATAGCAGCACAGAAGGGACTGGACCCATACAATATGCTACCTCCAAAGGCAGCT
TCAGGCACCAAGGAAGACCCTAATCTAGTCCCGTCCATCAGCAACAAGAGAATAGTGGGCTGCATCTGTG
AAGAGGACAACTGTACTGTCATCTGGTTTTGGCTGCACAAAGGCGAGAGTCAGCGATGCCCCAACTGTGG
AACCCATTACAAGCTGGTGCCCCACCAAATGGCCCACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_009942
ORF Size 390 bp
Insert Size 390
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_009942.2, NP_034072
RefSeq Size 584
RefSeq ORF 390
Locus ID 12859
Cytogenetics 1|1 B
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.