Cd59a (NM_007652) Mouse Untagged Clone
CAT#: MC208253
Cd59a (untagged) - Mouse CD59a antigen (Cd59a), transcript variant 2, (10ug)
"NM_007652" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cd59a |
Synonyms | AA987121; Cd59; protectin |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208253 representing NM_007652
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGAGCTCAGAGGGGACTCATCTTACTCCTGCTGCTTCTGGCTGTGTTCTGTTCCACAGCTGTTAGCC TCACATGCTACCACTGTTTCCAACCGGTGGTTTCTTCATGCAATATGAACAGCACTTGCTCTCCTGACCA GGATTCCTGTCTCTATGCTGTAGCCGGAATGCAAGTGTATCAAAGGTGTTGGAAACAATCAGATTGTCAT GGTGAGATCATTATGGACCAATTAGAAGAGACAAAATTAAAATTCAGATGCTGCCAGTTTAACTTGTGTA ACAAAAGTGACGGATCCTTGGGGAAGACACCATTGCTGGGGACCTCGGTTCTGGTGGCCATTTTGAATCT TTGTTTCTTAAGTCATCTCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_007652 |
Insert Size | 372 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_007652.5, NP_031678.1 |
RefSeq Size | 1747 bp |
RefSeq ORF | 372 bp |
Locus ID | 12509 |
UniProt ID | O55186 |
Cytogenetics | 2 54.53 cM |
Gene Summary | Potent inhibitor of the complement membrane attack complex (MAC) action. Acts by binding to the C8 and/or C9 complements of the assembling MAC, thereby preventing incorporation of the multiple copies of C9 required for complete formation of the osmolytic pore (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224362 | Cd59a (tGFP-tagged) - Mouse CD59a antigen (Cd59a) transcript variant 2, (10ug) |
USD 350.00 |
|
MR224362 | Cd59a (Myc-DDK-tagged) - Mouse CD59a antigen (Cd59a), transcript variant 2 |
USD 150.00 |
|
MR224362L3 | Lenti ORF clone of Cd59a (Myc-DDK-tagged) - Mouse CD59a antigen (Cd59a), transcript variant 2 |
USD 450.00 |
|
MR224362L4 | Lenti ORF clone of Cd59a (mGFP-tagged) - Mouse CD59a antigen (Cd59a), transcript variant 2 |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review