Skp1a (NM_011543) Mouse Untagged Clone

CAT#: MC208046

Skp1a (untagged) - Mouse S-phase kinase-associated protein 1A (Skp1a), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Skp1a
• Synonyms: 15kDa; 2610043E24Rik; 2610206H23Rik; EMC19; OCP-II; OCP2; p19A; p19Skp1; SKP1; Tceb1l
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208046 representing NM_011543
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCTACGATAAAGTTGCAGAGTTCTGATGGAGAGATATTTGAAGTTGATGTAGAAATTGCCAAACAAT
  CTGTGACTATCAAGACCATGCTGGAAGATTTGGGAATGGATGATGAAGGAGATGATGATCCTGTTCCTTT
  ACCAAATGTTAATGCAGCAATTCTAAAGAAGGTCATTCAGTGGTGCACCCACCACAAAGATGACCCTCCT
  CCTCCTGAGGATGATGAAAACAAAGAAAAGCGGACAGATGATATTCCTGTTTGGGACCAAGAATTCCTGA
  AAGTTGACCAAGGAACACTTTTTGAACTTATTCTGGCTGCAAACTACTTAGACATCAAAGGTTTGCTTGA
  TGTCACATGCAAGACTGTGGCCAATATGATTAAGGGGAAAACTCCTGAGGAGATTCGTAAAACCTTCAAT
  ATCAAAAATGACTTTACTGAAGAGGAAGAGGCCCAGGTACGCAAAGAGAACCAATGGTGTGAAGAGAAGT
  GA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_011543
• Insert Size: 492 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_011543.4, NP_035673.3
• RefSeq Size: 1454 bp
• RefSeq ORF: 492 bp
• Locus ID: 21402
• UniProt ID: Q9WTX5
• Cytogenetics: 11 31.86 cM
• Gene Summary: Essential component of the SCF (SKP1-CUL1-F-box protein) ubiquitin ligase complex, which mediates the ubiquitination of proteins involved in cell cycle progression, signal transduction and transcription. In the SCF complex, serves as an adapter that links the F-box protein to CUL1. The functional specificity of the SCF complex depends on the F-box protein as substrate recognition component. SCF(BTRC) and SCF(FBXW11) direct ubiquitination of CTNNB1 and participate in Wnt signaling. SCF(FBXW11) directs ubiquitination of phosphorylated NFKBIA. SCF(BTRC) directs ubiquitination of NFKBIB, NFKBIE, ATF4, SMAD3, SMAD4, CDC25A, FBXO5, CEP68 and probably NFKB2. SCF(SKP2) directs ubiquitination of phosphorylated CDKN1B/p27kip and is involved in regulation of G1/S transition. SCF(SKP2) directs ubiquitination of ORC1, CDT1, RBL2, ELF4, CDKN1A, RAG2, FOXO1A, and probably MYC and TAL1. SCF(FBXW7) directs ubiquitination of cyclin E, NOTCH1 released notch intracellular domain (NICD), and probably PSEN1. SCF(FBXW2) directs ubiquitination of GCM1. SCF(FBXO32) directs ubiquitination of MYOD1. SCF(FBXO7) directs ubiquitination of BIRC2 and DLGAP5. SCF(FBXO33) directs ubiquitination of YBX1. SCF(FBXO11) directs ubiquitination of BCL6 and DTL but does not seem to direct ubiquitination of TP53. SCF(BTRC) mediates the ubiquitination of NFKBIA at 'Lys-21' and 'Lys-22'; the degradation frees the associated NFKB1-RELA dimer to translocate into the nucleus and to activate transcription. SCF(CCNF) directs ubiquitination of CCP110. SCF(FBXL3) and SCF(FBXL21) direct ubiquitination of CRY1 and CRY2. SCF(FBXO9) directs ubiquitination of TTI1 and TELO2 (By similarity).[UniProtKB/Swiss-Prot Function]