Terf2ip (NM_020584) Mouse Untagged Clone

CAT#: MC207538

Terf2ip (untagged) - Mouse telomeric repeat binding factor 2, interacting protein (Terf2ip), (10ug)


  "NM_020584" in other vectors (3)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Terf2ip"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Terf2ip
Synonyms Rap1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207538 representing NM_020584
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGAGGCGATGGATCTGGGTAAAGACCCCAATGGGCCCACTCACTCCTCCACTCTGTTCGTGAGAG
AAGACGGCAGCGCCATGTCGTTTTACGTGCGGCCCAGCTCGGCCAAGCGCCGGCTGTCGACGCTCATCCT
GCACGGCGGCGGCACCGTGTGTCGGGTGCAGGAACCCGGAGCCGTGCTTCTCGCCCAGCCCGGGGAGGCG
CTGGCCGAGGCTTCGGGCGACTTCATCTCCACGCAGTACATCCTAGACTGCGTGGATCGCAACGAGAAGC
TGGACCTGGAGGCCTATCGGCTGGGCCTGACGGAGCAGGCGTCCGATCCGAAGCCCGGGGCTTCCACCGA
GGGCTCCACGGAACCGGAGCCGCAGCCCCTGACCGGGCGCATCGCCTACACCGACGCGGAAGATGTGGCC
ATCCTGACCTACGTGAAGGAGAACGCCCGTTCGCCCAGCTCGGTCACAGGCAATGCCTTGTGGAAAGCGA
TGGAGAAGAGCTCGCTCACGCAGCACTCCTGGCAGTCGCTCAAGGACCGCTACCTCAAGCACCTACGGGG
TCAGGAGCACAAGTACCTGCTCGGGAACGCCCCGGTCAGCCCGTCCTCCCAGAAGCTCAAACGGAAGGCG
GAGCAGGACCCCGAGGCCGCGGATAGCGGAGAGCCACAGAACAAGAGAGCGCCAGACTTGCCTGAGGAGG
AGTGTGTGAAAGGAGAGATCAAGGAGAATGGAGAGGCAGACAACAAGCTGTTTGAGGAAGCCGCTCCGGA
GTTCGGAGAAGCCGTGGTGGATGAGAGCCCTGACTTTGAAATACATATAACGATGTGTGATGGTGATCCA
CCCACACCCGAGGAAGACTCAGAAACACAGCCAGACGAGGAGGAAGAAGAACCAAAAGTTTCTACGCAAG
AAGTGGGAACTGCCATTAAGGTGATCCGGCAGCTAATGGAGAAGTTCAACTTGGATCTATCAACAGTTAC
ACAGGCCTTGCTGAAGAACAGTGGTGAGCTGGAGGCCACGTCCTCCTTCTTAGAGTCGGGGCGGAGACCC
GACGGTTATCCCATTTGGTGCAGACAAGATGACTTAGATTTGCAGAAGGACGATGACGACACGAAAAATG
CACTGGTCAAAAAGTTTGGAGCTCAGAACGTTGCTCGGAGGATTGAATTCCGAAAGAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_020584
Insert Size 1182 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_020584.2, NP_065609.2
RefSeq Size 3599 bp
RefSeq ORF 1182 bp
Locus ID 57321
UniProt ID Q91VL8
Cytogenetics 8 E1
Gene Summary Acts both as a regulator of telomere function and as a transcription regulator. Involved in the regulation of telomere length and protection as a component of the shelterin complex (telosome). In contrast to other components of the shelterin complex, it is dispensible for telomere capping and does not participate in the protection of telomeres against non-homologous end-joining (NHEJ)-mediated repair. Instead, it is required to negatively regulate telomere recombination and is essential for repressing homology-directed repair (HDR), which can affect telomere length. Does not bind DNA directly: recruited to telomeric double-stranded 5'-TTAGGG-3' repeats via its interaction with TERF2. Independently of its function in telomeres, also acts as a transcription regulator: recruited to extratelomeric 5'-TTAGGG-3' sites via its association with TERF2 or other factors, and regulates gene expression. When cytoplasmic, associates with the I-kappa-B-kinase (IKK) complex and acts as a regulator of the NF-kappa-B signaling by promoting IKK-mediated phosphorylation of RELA/p65, leading to activate expression of NF-kappa-B target genes.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.