Xbp1 (NM_013842) Mouse Untagged Clone
CAT#: MC207445
Xbp1 (untagged) - Mouse X-box binding protein 1 (Xbp1), (10ug)
"NM_013842" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Xbp1 |
Synonyms | D11Ertd39e; TREB-5; TREB5; XBP-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207445 representing NM_013842
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTGGTGGTGGCAGCGGCGCCGAGCGCGGCCACGGCGGCCCCCAAAGTGCTACTCTTATCTGGCCAGC CCGCCTCCGGCGGCCGGGCGCTGCCGCTCATGGTACCCGGTCCGCGGGCAGCAGGGTCGGAGGCGAGCGG GACACCGCAGGCTCGCAAGCGGCAGCGGCTCACGCACCTGAGCCCGGAGGAGAAAGCGCTGCGGAGGAAA CTGAAAAACAGAGTAGCAGCGCAGACTGCTCGAGATAGAAAGAAAGCCCGGATGAGCGAGCTGGAGCAGC AAGTGGTGGATTTGGAAGAAGAGAACCACAAACTCCAGCTAGAAAATCAGCTTTTACGGGAGAAAACTCA CGGCCTTGTGGTTGAGAACCAGGAGTTAAGAACACGCTTGGGAATGGACACGCTGGATCCTGACGAGGTT CCAGAGGTGGAGGCCAAGGGGAGTGGAGTAAGGCTGGTGGCCGGGTCTGCTGAGTCCGCAGCACTCAGAC TATGTGCACCTCTGCAGCAGGTGCAGGCCCAGTTGTCACCTCCCCAGAACATCTTCCCATGGACTCTGAC ACTGTTGCCTCTTCAGATTCTGAGTCTGATATCCTTTTGGGCATTCTGGACAAGTTGGACCCTGTCATGT TTTTCAAATGTCCTTCCCCAGAGTCTGCTAGTCTGGAGGAACTCCCAGAGGTCTACCCAGAAGGACCTAG TTCCTTACCAGCCTCCCTTTCTCTGTCAGTGGGGACCTCATCAGCCAAGCTGGAAGCCATTAATGAACTC ATTCGTTTTGACCATGTATACACCAAGCCTCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_013842 |
Insert Size | 804 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC029197, AAH29197 |
RefSeq Size | 1797 bp |
RefSeq ORF | 804 bp |
Locus ID | 22433 |
UniProt ID | O35426 |
Cytogenetics | 11 3.61 cM |
Gene Summary | Functions as a transcription factor during endoplasmic reticulum stress by regulating the unfolded protein response (UPR). Required for cardiac myogenesis and hepatogenesis during embryonic development and the development of secretory tissues such as exocrine pancreas and salivary gland (PubMed:10425189, PubMed:10652269, PubMed:16362047, PubMed:17612490). Involved in differentiation of B lymphocytes to plasma cells and production of immunoglobulins. Modulates the cellular response to ER stress in a PIK3R-dependent manner. Binds to the cis-acting X box present in the promoter regions of major histocompatibility complex class II genes (By similarity). Involved in VEGF-induced endothelial cell (EC) proliferation and retinal blood vessel formation during embryonic development but also for angiogenesis in adult tissues under ischemic conditions (PubMed:23529610). Functions also as a major regulator of the UPR in obesity-induced insulin resistance and type 2 diabetes for the management of obesity and diabetes prevention (PubMed:15486293).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript but encodes the shorter isoform, XBP1(U). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203542 | Xbp1 (tGFP-tagged) - Mouse X-box binding protein 1 (Xbp1) |
USD 650.00 |
|
MR203542 | Xbp1 (Myc-DDK-tagged) - Mouse X-box binding protein 1 (Xbp1) |
USD 450.00 |
|
MR203542L1 | Lenti ORF clone of Xbp1 (Myc-DDK-tagged) - Mouse X-box binding protein 1 (Xbp1) |
USD 750.00 |
|
MR203542L3 | Lenti ORF clone of Xbp1 (Myc-DDK-tagged) - Mouse X-box binding protein 1 (Xbp1) |
USD 750.00 |
|
MR203542L4 | Lenti ORF clone of Xbp1 (mGFP-tagged) - Mouse X-box binding protein 1 (Xbp1) |
USD 750.00 |
{0} Product Review(s)
Be the first one to submit a review