Egfbp2 (NM_010115) Mouse Untagged Clone

CAT#: MC207264

Egfbp2 (untagged) - Mouse epidermal growth factor binding protein type B (Egfbp2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Egfbp2
• Synonyms: Egfbp-2; Klk1b26; mGk-13; PRECE-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207264 representing NM_010115
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTGGTTCCTGATCCTGTTCCTAGCCCTGTCCCTAGGAGGGATTGATGCTGCACCTCCTCTCCAGTCTC
  GGGTGGTTGGAGGATTTAACTGTAAGAAGAATTCCCAACCCTGGCAGGTGGCTGTGTACTACCAAAAGGA
  ACACATTTGTGGGGGTGTCCTGTTGGACCGCAACTGGGTTCTCACAGCTGCCCACTGCTATGTCGACCAG
  TATGAGGTTTGGCTGGGCAAAAACAAGTTATTCCAAGAGGAACCCTCTGCTCAGCACCGATTGGTCAGCA
  AAAGCTTCCCTCACCCTGGCTTCAACATGAGCCTCCTGATGCTTCAAACAATACCTCCTGGGGCTGACTT
  CAGCAATGACCTGATGCTGCTCCGCCTCAGCAAGCCTGCTGACATCACAGATGTTGTGAAGCCCATCGCC
  CTGCCCACAAAGGAGCCCAAGCCGGGGAGCAAATGCCTAGCCTCAGGCTGGGGCAGCATTACACCCACAA
  GATGGCAAAAGCCAGATGATCTTCAGTGTGTGTTCATCACGCTCCTGCCCAATGAGAACTGTGCCAAAGT
  CTACCTACAGAAAGTCACAGATGTCATGCTGTGTGCAGGAGAGATGGGTGGAGGCAAAGACACTTGTAGG
  GATGACTCCGGAGGCCCACTGATTTGTGATGGTATTCTCCAAGGAACCACATCATATGGCCCTGTACCAT
  GCGGTAAACCTGGTGTACCAGCCATCTACACCAACCTTATTAAGTTCAACTCCTGGATAAAAGATACTAT
  GATGAAAAATGCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010115
• Insert Size: 786 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_010115.6, NP_034245.3
• RefSeq Size: 858 bp
• RefSeq ORF: 786 bp
• Locus ID: 13647
• UniProt ID: P36368
• Cytogenetics: 7
• Gene Summary: The protein encoded by this gene belongs to the kallikrein family, which is a highly homologous group of serine proteases encoded by a cluster of related genes on chromosome 7. This gene has been shown to function as both a prorenin converting enzyme and as epidermal growth factor (EGF)-binding protein involved in the maturation of EGF (PMIDs: 1918045, 3322387, 9685728). This gene is thought to be distinct from Klk1b26 gene (GeneID:16618), with which it shares 98% identity (PMID:1959648, 9685728), however, it is not clear if both genes are present in all strains of mice. Blast analyses suggest that this gene is missing from the current reference (GRCm38, based on C57BL/6J genome) and alternate Celera (based on mixed strain genomes) assemblies. Therefore, the RefSeq for this locus was based on sequence from the ICR strain, which has been reported in literature (PMID:1959648) to contain both genes. [provided by RefSeq, Aug 2012]