Ap1s3 (BC098237) Mouse Untagged Clone
CAT#: MC207179
Ap1s3 (untagged) - Mouse adaptor-related protein complex AP-1, sigma 3 (cDNA clone MGC:106818 IMAGE:3825593), (10ug)
"BC098237" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Ap1s3 |
Synonyms | [s]3A, Jr2, 1190009B22 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC098237
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATACATTTCATCTTGCTCTTCAGTCGACAAGGGAAGCTGCGGCTGCAGAAATGGTACACCACACTCC CTGACAAGGAGAGGAAGAAGATCACCCGCGACATCATCCAGACCGTCCTCTCTCGTGGGCACAGGACCAG CAGCTTCATTGACTGGAAGGAGCTGAAACTTGTTTATAAAAGGTATGCTAGTTTATATTTTTGCTGTGCA ATAGAAAATCAAGACAATGAGCTCTTGACACTAGAGATTGTTCATCGTTATGTGGAGTTGCTGGATAAAT ACTTTGGAAATGTCTGTGAGCTGGATATTATCTTTAATTTTGAAAAGGCATATTTTATCCTTGATGAGTT TATAATAGGTGGAGAAATTCAGGAAACATCCAAGAAAACAGCAGTCAAGGCCATTGAAGACTCTGATATG TTACAAGAGACAATGGAAGAATACATGAACAAGCCCACGTTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | BC098237 |
Insert Size | 465 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC098237, AAH98237 |
RefSeq Size | 1298 bp |
RefSeq ORF | 464 bp |
Locus ID | 252903 |
Cytogenetics | 1 C4 |
Gene Summary | Subunit of clathrin-associated adaptor protein complex 1 that plays a role in protein sorting in the late-Golgi/trans-Golgi network (TGN) and/or endosomes. The AP complexes mediate both the recruitment of clathrin to membranes and the recognition of sorting signals within the cytosolic tails of transmembrane cargo molecules (By similarity). Involved in TLR3 trafficking (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201140 | Ap1s3 (tGFP-tagged) - Mouse adaptor-related protein complex AP-1, sigma 3 (cDNA clone MGC:106818 IMAGE:3825593) |
USD 350.00 |
|
MR201140 | Ap1s3 (Myc-DDK-tagged) - Mouse adaptor-related protein complex AP-1, sigma 3 (cDNA clone MGC:106818 IMAGE:3825593) |
USD 150.00 |
|
MR201140L3 | Lenti ORF clone of Ap1s3 (Myc-DDK-tagged) - Mouse adaptor-related protein complex AP-1, sigma 3 (cDNA clone MGC:106818 IMAGE:3825593) |
USD 450.00 |
|
MR201140L4 | Lenti ORF clone of Ap1s3 (mGFP-tagged) - Mouse adaptor-related protein complex AP-1, sigma 3 (cDNA clone MGC:106818 IMAGE:3825593) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review