Tab1 (NM_025609) Mouse Untagged Clone

CAT#: MC204661

Tab1 (untagged) - Mouse TGF-beta activated kinase 1/MAP3K7 binding protein 1 (Tab1), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tab1 (NM_025609) Mouse Untagged Clone
Symbol Tab1
Synonyms 2310012M03Rik; b2b449Clo; Map3k7ip1
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC054369
AGATGGCGGCGCAGAGGAGGAGCCTGCTCCAGAGTGAGCAGCAGCCAAGCTGGACAGATGACCTGCCACT CTGTCACCTCTCTGGAGTTGGTTCAGCGTCCAACCGCAGCTACTCTGCTGATGGCAAGGGCACTGAGAGC CACCCTCCGGAGGACAACTGGCTTAAGTTCAGAAGTGAAAATAACTGCTTCCTGTACGGGGTCTTCAATG GCTATGATGGCAACCGCGTGACCAACTTTGTGGCGCAGAGGCTTTCTGCAGAGCTCCTGCTGGGCCAGCT CAACACTGAGCACACTGAGGCTGATGTGCGACGGGTCCTGCTGCAGGCCTTTGATGTGGTGGAGAGGAGC TTCCTGGAGTCTATCGATGATGCCTTAGCTGAGAAAGCAAGCCTCCAGTCCCAGCTGCCGGAGGGTGTGC CCCAGCACCAGCTGCCACCTCAGTACCAGAAGATCCTTGAGAGACTCAAGGCACTGGAGAGGGAGATTTC GGGAGGAGCCATGGCTGTCGTGGCAGTCCTTCTCAACAGCAAGCTCTACGTTGCCAATGTCGGTACGAAC AGGGCCCTTCTGTGCAAATCTACAGTGGATGGGTTACAGGTTACACAGCTAAACATGGACCACACCACCG AGAACGAGGACGAGCTCTTTCGGCTTTCGCAACTGGGTTTAGACGCAGGGAAGATCAAGCAGATGGGCGT CATCTGTGGACAGGAGAGCACCAGGCGGATTGGGGATTACAAGGTCAAATATGGCTACACCGACATTGAC CTGCTCAGCGCTGCCAAGTCCAAACCCATCATCGCAGAGCCGGAAATTCATGGCGCACAGCCTCTGGATG GCGTGACGGGCTTCCTGGTGCTGATGTCAGAGGGGCTGTACAAGGCCCTGGAGGCAGCCCATGGGCCTGG GCAGGCCAACCAGGAGATTGCCGCGATGATTGACACCGAGTTTGCCAAGCAGACCTCCCTGGATGCGGTT GCCCAGGCTGTGGTAGACCGTGTAAAGCGGATCCACAGTGACACCTTTGCCAGTGGTGGGGAGCGTGCCA AGTTCTGCCCACGGCATGAAGACATGACCCTGCTGGTGAGGAACTTTGGCTATCCATTGGGTGAAATGAG CCAGCCTACACCGACCCCTGCCCCAGGGGGCCGTGTGTACCCTGTTTCTGTGCCCTACTCAAGTGCCCAG AGCACCAGCAAGACTAGTGTGACTCTGTCCCTCGTCATGCCTTCTCAGGGCCAGATGGTCAACGGCTCTC ACAGTGCCTCCACTCTGGACGAAGCCACTCCCACACTCACTAACCAGAGCCCCACTCTGACCCTGCAGTC CACCAACACGCACACCCAGAGCAGCAGCTCCAGCTCTGACGGGGGCCTCTTCCGCTCCAGACCGGCTCAC TCACTTCCACCCGGAGAGGATGGCCGTGTGGAGCCCTATGTGGACTTTGCTGAGTTCTACCGACTCTGGA GCGTGGACCACGGCGAGCAGAGCGTGATGACGGCACCTTAGTCTAGCCTCAGAGTGCAGCCTGGGCACAA CTTTGTGTAGACACAGAGGGCCAGTGCCAAAGCAAGACAAGCTTCCTGACCTTTGCGGGGGCCATGGAAC CCTCGGGCAGTGAGTCATGACGTGCTGCAGGTTCAACCACAGCCCTGGGCTGTGGCCTGAGTACAGACTG CATTGCTGCTGGTCCACACAGGAGGCTGGAGTCCAGACCACAGGCATCCTAAGACAGGGCCAAGCGGGAA AGCTGCAGGTAGCTTACAAACCATCACGAGTGCCTCCTGACACGTTTAAAGACTAGCAAGATGCCGTCCT GTGGACCCCAGCTACCAAAGGCCAGACAGACACTGCTCCCTCAAGACTCCTCCACCTGCTTCAGCTTCCC CCGGAAGAGCTGTGGCCTCTGCGAGTGCCCGTTACCTCTGGGTGGCTATCCCCTTTCCACCTTTCAGCCC AAACTCCTAGATCCAGAGTAGCGAATAACAGGAGTGGGTGCCTGTCACTGGATGTCACTGGAAAAGTCCA GGGAAGCAGAGGGGTTATTAACAGCCACAGAGGAGCAAGACAAGGAAGTACCAGAGAGAGCTGGCCAAGG AATGCTAGTCCTGGGCTGCAGGTCAGCCAGCTGGCAGCTGAGCTAACTCAGAGAGCTGGCTTCCCAATGG GGTGCAGTTAGTAGGCCAGGCCCACCAGGCAGCTGCAGTTCTGCTTCTGCTAGATCCTGCCCTGGGGTGA GGCAGGCCAAGTCAGAAGCCAGTGCCTTCCTCCCAGCGGGTCCTGGGAAGCCAGTGATAGGGGGTGCTGA GGCAACAGACCTCACGCTGATGAGGAGGCTGCTTGGTTCCGGGCTCTGCCGAAAGAGGAGTGGGATACGG CTGTGAGAGGGCCGAGGTTGAGTCTTGCTCACCCAGAAGACCAAGGACATCAGGTGCAGTGATGCGGACG TGCAGGGAAAAGACTCTGCTGGTCAGGCCCTGACTGGGACCTGTTCACACAGAATCTCTCCCTTCAGACA GGAGGGTTACCACAGCTGCCTGCAGTGTGGCCACCCCTGTGCTCAGAGGAGAAAGGCTGGGTGCTCCTCT TACCTGAGCCCTTCCATCAGGATTAAATCTGCAGCCCTTTCCCCACTGTGTGCAGCTACTGGGCAGGGTG CCCAGTGTGGCCTGGTGGCAAAGGCCAATTCAGAGCACTTCTCAGACTCCATTTCCCTAAAGCGAGGCTG CTGGCTCCATGCTGAGGAGAAGCCCTGGGGTGATGGGAAGAAGAAGCCTTCCTGCTCTCCACTAGGAAGT CACCTCTGCCCTGCAGGTGCCCTGCAGGTGAGCAGCTCTCAGCTGGTGCACAAGGACATGGGACAAAGGA GGTCCTCCCCAAGGAATGTGGTGCTGTTTGGTCTCTAGAAATAGAACCATGTTCTTCATGCAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_025609
ORF Size 1509 bp
Insert Size 1509
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC054369, NP_079885
RefSeq Size 3013
RefSeq ORF 1509
Locus ID 66513
Cytogenetics 15|15 E1
Gene Summary May be an important signaling intermediate between TGFB receptors and MAP3K7/TAK1. May play an important role in mammalian embryogenesis. [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.