Abcb8 (NM_029020) Mouse Untagged Clone

CAT#: MC203835

Abcb8 (untagged) - Mouse ATP-binding cassette, sub-family B (MDR/TAP), member 8 (Abcb8), nuclear gene encoding mitochondrial protein, (10ug)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Abcb8 (NM_029020) Mouse Untagged Clone
Symbol Abcb8
Synonyms 4833412N02Rik; AA409895
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC015301
AAGGATGGGAGCATAGAGATTGTCTGGAACAACTCTAGAGAAAGGGCTCAAGGTCAGAAGCGCCAGGACG TCCTCTAATGTGAGAATGAACGTCGCACAACCTCTGACCCGCACCTGACTTCAGGCCACTGAGCAAATAG CTAGAGCTGCTTCTGCTCGGTCCCGCCTACAGCCAACATTTTATCCAATCACAGCTTGCAGCAAGACTGA TGTGTCTTTTCTCCAATCATCGCTGAGAATGGGAAGGGGTTGTCGGGATGGGGCCATAGCGAACATGGAA CCCTCGGTAGGATAAGTGTGAGATTGCCGTTGCTGGCTGCCCCTATCTTATTGCCTCAACATGTTGGTGC ACTTATTTCGGTTCGGAATCCGGGGTGGCCCAGTTCCAGGATGGTCGCTACAATCCCTGCGCTTCCAGAC GTTCTCTGCCGCCAGGTCCTCAGATGACCGGCTCAGCTCACACCTCCTGCGGACTGTAGCCCAGCTCCGT GTACAGCTCCGGGCTCACCTCCCTCGAGCCCCACCAGCTTCCCACTGGAGCCCCTCTGCCTGGTGTTGGG TTGGGGGGACCTTGGTGGTCCCTGCAGTCCTGTGGCAGCATCCACGCCTCTGCCTTATAGCACTATGTGA GGCCAAAGAGTCCCCTCCTGCCCAGCCCACACGTGCCCCAGAGCTGCGCTTTAATTGGAAGCTCTTCTGG CATTTCCTTCACCCCCACCTGCTGGCCTTGGGGGCAGCCATTGTGCTGGCCTTAGGTGCGGCACTAGTGA ATGTGCAGATCCCCTTGCTCCTGGGCCAGCTGGTGGAGATTGTCGCCAAGTACACGAGGGACCACATGGG GAGTTTCGTGTCTGAGTCCCGTAAGCTCAGCGTCCAGCTGCTCCTACTGTACGGTGTTCAGGGACTGCTG ACCTTTGGATACCTAGTGCTGCTGTCCCACATTGGTGAGCGCATGGCCATGGACATGCGGAAAGCCCTTT TCAGCTCCCTGCTCCGGCAAGACATTGCTTTCTTTGATGCCAAAAAGACAGGGCAGCTAGTGAGTCGCTT GACTACTGATGTGCAAGAATTCAAGTCATCCTTCAAGCTTGTCATCTCCCAGGGACTGCGCAGCTGCACC CAGGTGATTGGTAGCCTGGTGTCCCTGTCTATGCTGTCCCCTCGCCTTACCCTGATGCTGGCTGTCGTCA CACCCGCCCTCATGGGAGTGGGCACCCTGATGGGCTCAGGCCTCCGAAAGCTGTCTCGCCAGTGTCAGGA GCAGATTGCCAGGGCAACAGGTGTAGCAGATGAGGCCCTTGGCAATGTTCGGACTGTGCGGGCCTTCGCG ATGGAGAAGAGGGAGGAGGAACGCTATCAAGCAGAACTGGAGTCATGCTGCTGTAAAGCAGAAGAACTGG GCAGGGGCATCGCCTTGTTCCAAGGGCTCTCCAACATCGCTTTCAACTGTATGGTCTTGGGCACCCTGTT CATTGGGGGCTCCCTTGTGGCTGGACAGCAGCTGAAAGGGGGAGACCTCATGTCCTTCCTGGTGGCTTCC CAGACAGTACAGAGGTCTATGGCCAGCCTCTCTGTCCTGTTTGGTCAGGTGGTACGTGGGCTGAGTGCGG GAGCCCGAGTCTTCGAATACATGGCCCTGAGCCCTGTCATCCCATTGACCGGGGGCTACTGCATCCCCAA CAAGGACATTCGTGGTTCCATCACCTTCCAAAATGTCACCTTCAGCTACCCCTGCAGACCTGGCTTCAAT GTGCTCAAGGACTTCACCCTGAAGCTGCCCTCTGGCAAGATTGTGGCTCTTGTGGGCCAGTCTGGGGGAG GAAAGACCACAGTTGCCTCCTTGCTGGAACGCTTCTATGACCCTGAAGCTGGCTCGGTGACGTTGGATGG GCATGACCTGCGAACTCTCAACCCCTCCTGGCTCCGGGGCCAGGTCATAGGTTTCATCAGCCAGGAGCCA GTCCTGTTTGCAACAACCATCATGGAGAATATCCGATTTGGGAAGCTGGATGCTTCCGATGAAGAGGTGT ACACAGCTGCACGAGAAGCCAATGCCCACGAGTTCATCAGCAGCTTCCCCGATGGCTACAGCACTGTGGT TGGTGAGCGGGGCACAACCTTGTCTGGTGGCCAGAAGCAGCGCCTAGCCATCGCACGTGCCCTCATCAAG CAGCCCACAGTGCTGATCCTGGACGAGGCCACCAGTGCGCTAGATGCAGAATCCGAGAGGGTGGTACAGG AGGCCCTGGACCGGGCCAGTGCTGGCCGCACCGTGTTGGTCATTGCCCACCGGCTTAGTACTGTCCGTGC AGCCCACTCCATCATTGTCATGGCCAATGGCCAAGTCTGTGAGGCTGGGACCCACGAAGAACTCCTTAAA AAAGGCGGGCTCTATTCAGAGCTTATCCGGAGACAAACCCTGGACGCCTCACTGACCTCAACCCCTCCTG CAGAGAAGCCTGAAGACCCCAAAAGCTGCCAGTCCAAAGCCTGAGAGGCCCCCTGGGGTCAGGTCACTGC AAGACATCAGTCTGAGGCTGGAGCTCTGCTGGGGACAGAGCCCTTGGAAGGCCAGTGTGCTGGAGTGTGG CCTGCACTACTGCCCCCTTAAAGGAGCTGGGCTCAACAGCTGGGGTGGGAAATGGCTCTCCGCCCACCTG CTCTGACCATCCTGACTCAGCTCTGTGGTCACGGGATGTACACAGTGAGACAGAGTCCCTGGACACCTCT GCTTGACCCTCTCAGGCTGGCCTGGTTCTGCCCAACACTCAGTTGTTTGGGCCCTCACTCCAGGAGACTG GCCAGGCCTGGTAGAATGGGTTGTAATCCCAGCACTTGGGAGACAGAAGTGGGAGGGTCAAGAGTTCAAG GCCATCCTGGGCTAAATAGTGAGACCCTCTCTCAACAAAAAGAAAAACCTAAATAAAGAGGAAAAATTTT CAAAGAGAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_029020
ORF Size 2154 bp
Insert Size 2154
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC015301, NP_083296
RefSeq Size 2962
RefSeq ORF 2154
Locus ID 74610
Cytogenetics 5|5 A3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.