S1pr1 (NM_007901) Mouse Untagged Clone

CAT#: MC202722

S1pr1 (untagged) - Mouse sphingosine-1-phosphate receptor 1 (S1pr1), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name S1pr1 (NM_007901) Mouse Untagged Clone
Symbol S1pr1
Synonyms AI849002; Edg1; Lpb1; S1p; S1p1
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC049094 sequence for NM_007901
CCCAGCCTCGGCGGGGCGCTCAGAGACTTCGTCTTGCAAAAGTGGTGCGGGCAGCGCAGGCAGGGCTGGC CATTGGAGTGCACCGCTGAGGAGGGAGGGGACCCCAGCTCAGGGAACTTTGCGAGTGAGCTGGTCGCCGT CAGTCGCCGACAGCAGCAAGATGCGGATCGCGCGGTGTAGACCCAGAGTCCTGCGGACGCAGCTTCGTCC GGCTTGAGCGAGGCTGCTGTTTCTCGGAGGCCTCTCCAGCCAAGGAAAAGCTCCATAAAAGAAAAAAGCA TTGGATTGCTCGCTGACCTGGCTTTGCTGTAACTGAAGGCTCACTCAACCTCGCCCTCTAGCGTTTGCCT GGAGAAATACCACCCCAGGCTCCTGGGGACACAATTAGCAGCTATGGTGTCCACTAGCATCCCGGAGGTT AAAGCTCTCCGCAGCTCAGTCTCTGACTATGGGAACTATGATATCATAGTCCGGCATTACAACTACACAG GCAAGTTGAACATCGGGGCGGAGAAGGACCATGGCATTAAACTGACTTCAGTGGTGTTCATTCTCATCTG CTGCTTCATCATCCTAGAGAATATATTTGTCTTGCTAACTATTTGGAAAACCAAGAAGTTCCACCGGCCC ATGTACTATTTCATAGGCAACCTAGCCCTCTCGGACCTATTAGCAGGCGTGGCTTACACAGCTAACCTGC TGTTGTCTGGGGCCACCACTTACAAGCTCACACCTGCCCAGTGGTTTCTGCGGGAAGGGAGTATGTTTGT GGCTCTCTCTGCATCAGTCTTCAGCCTCCTTGCCATCGCCATTGAGCGCTACATCACCATGCTGAAGATG AAACTACACAACGGGAGCAACAGCTCGCGCTCCTTTCTGCTGATCAGCGCCTGCTGGGTCATCTCCCTCA TCCTGGGGGGCCTGCCCATCATGGGCTGGAACTGCATCAGCTCGCTGTCTAGCTGCTCCACCGTGCTCCC GCTCTACCACAAGCACTATATTCTCTTCTGCACCACCGTCTTCACTCTGCTCCTGCTTTCCATCGTCATC CTCTACTGCAGGATCTACTCCTTGGTCAGGACTCGAAGCCGCCGCCTGACCTTCCGCAAGAACATCTCCA AGGCCAGTCGCAGTTCTGAGAAGTCTCTGGCCTTGCTGAAGACGGTGATCATTGTCCTGAGTGTCTTCAT TGCCTGCTGGGCCCCTCTCTTCATCCTACTACTGTTAGATGTGGGCTGCAAGGCGAAGACCTGTGACATC CTGTACAAAGCAGAGTACTTCCTGGTTCTGGCTGTGCTGAACTCAGGTACCAACCCCATCATCTACACTC TGACCAACAAGGAGATGCGCCGGGCCTTCATCCGGATCGTATCTTGTTGCAAATGCCCCAACGGAGACTC TGCTGGCAAATTCAAGAGGCCCATCATCCCAGGCATGGAATTTAGCCGCAGCAAATCAGACAACTCCTCT CACCCCCAGAAGGACGATGGGGACAACCCAGAGACCATTATGTCGTCTGGAAACGTCAATTCTTCTTCCT AAAGCCTGAAGAAGCTGTTGATACTGAGGGAAGCATTCTGACTTGATCACCCACTACCCCAGCATTTCAA AAATGTCTCTCGCTCTCCACTGCTGCAAGGAAGGAGCAACTGGGAGCCTGAGAGAGGGAGGGAAGGGAGA ATGTGCGGCCTGGTGATACCATGATGTAGGTAGGTAGTAATTGTGAACAATGCACTGGGAAGGGTGGAGA TCAGGTCTGGCCTGCAGTGGGTTTCCTGCCCCCCCCTCCCCCGTACCCTGGAGCTTTGATTTTGCACTGA GCCAAAGGTCTAGCATTGTCAAGCTCCCAGAGGGCTCATCTGGTCCCTCCTCAAAGACTAAGGTCCCAAG AGAAAGTGTTGTGATCTCTCACTGTAATGTCAAAGTGAGTATGTGCCCTTTAGCTTGGTTGGGTGGTGTA CATGTCCCCACCCTCCGGTTTCTTCTCACCCTGTCTCCCCTTACCACCCCTTCTTTATATCGTAACTGCC TGACTTTTGTTCATCAGAAGGAGGTTGTGGAGGGGTCTATTTCTTGATTATAGTGAGCAAGCTATTTGCT GGGAAGGCTATTTGCTGAGGCCAAAGTTTCCATGTAAACTGGGTCAAGTTGTTGGGAATTTGGTAGGCCA TCTTTAAGATGAAAATGTGTTCCTTTTTTGTCACATGTTCCTTATTCCCATTACAACCACAATGGTTGTG AATGAAGAGTAACAAAGAATAACGAAGTCTACTTTATTTGAATTATACTGGGCAGAATCTTAGATGATAC GGGAAAAGCAAAAAACAAACAAACAAACAAACAAACAAACAAAAATCTACAGCATGAGGTGAAATGTGAG AGTTAAGTCGTGCAGACCAAGAGCTGTTTCTTGCTGTCTTTCTCTAACCCCTACAGCACCTTTGGCACTT TTATTGATGATTTCAGAATGTTGTGTGATCCATTTCAACCAACTGGGGGAGAGTTGTATTTTGTTTAAAG AACATTTTCTGATTTTCGAATGTATTTGTTTCTTTGAGGTCATCTTATTGAACTTCTTCCTAACCCGTGT TAACACCACTGAATGTGTAGTTCTTAAGAAAGTGTCATCCTTTTGTACCCCCCACTCCCCAAAAGCATTA CTTTAACTGACAGGGAACATCAGGAATTCTTTATTTCGGCTGTCACTAGGTATTGATGATGGTTATAAAT GTTACAGAGAATAAAAATATATTAGTCTCTTTAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
Tag Tag Free
ACCN NM_007901
ORF Size 1149 bp
Insert Size 1149
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC049094, NP_031927
RefSeq Size 2781
RefSeq ORF 1149
Locus ID 13609
Cytogenetics 3|3 G1
Gene Summary This gene encodes a G-protein-coupled receptor bound by the lysophospholipid, sphingosine 1-phosphate. The gene product functions in endothelial cells and is involved in vascular and heart development. This receptor is highly expressed in T and B lymphocytes, and it plays a role in T cell and B cell export from peripheral lymphoid organs. This protein is bound and downregulated by FTY720, an exogenous immunosuppressant drug studied in mouse disease models for multiple sclerosis in humans. [provided by RefSeq, Jan 2010].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.