Telomerase reverse transcriptase (TERT) Human qPCR Primer Pair (NM_198253)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
TERT (Myc-DDK-tagged)-Human telomerase reverse transcriptase (TERT), transcript variant 1
USD 985.00
Mouse Monoclonal Antibody against Telomerase reverse transcriptase (2C4) - Embryonic Stem Cell Marker
USD 620.00
Other products for "TERT"
Specifications
Product Data | |
Gene ID | 7015 |
Forward Sequence | GCCGATTGTGAACATGGACTACG |
Reverse Sequence | GCTCGTAGTTGAGCACGCTGAA |
Accession No | NM_198253, NM_198253.1, NM_198253.2, BC062321, BC156388, BC172541 |
UniProt ID | O14746 |
Synonyms | CMM9; DKCA2; DKCB4; EST2; hEST2; hTRT; PFBMFT1; TCS1; TP2; TRT |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.