HSD11B1 Human qPCR Primer Pair (NM_005525)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
HSD11B1 (Myc-DDK-tagged)-Human hydroxysteroid (11-beta) dehydrogenase 1 (HSD11B1), transcript variant 1
USD 450.00
Rabbit polyclonal antibody to HSD11B1 (hydroxysteroid (11-beta) dehydrogenase 1)
USD 625.00
Other products for "HSD11B1"
Specifications
Product Data | |
Gene ID | 3290 |
Forward Sequence | GTTACGTGGTCCTGACTGTAGC |
Reverse Sequence | GCAGCAACCATTGGATAAGCCAC |
Accession No | NM_005525, NM_005525.1, NM_005525.2, NM_005525.3, BC012593, BC012593.1, BG619051, BM994393, BX345837, NM_005525.4 |
UniProt ID | P28845 |
Synonyms | 11-beta-HSD1; 11-DH; CORTRD2; HDL; HSD11; HSD11B; HSD11L; SDR26C1 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.