APC Human Gene Knockout Kit (CRISPR)

CAT#: KN211629

Reviews ()
Write a review

APC - human gene knockout kit via CRISPR, HDR mediated

HDR-mediated knockout kit validation

  See Other Versions

USD 1,290.00

4 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol APC
Locus ID 324
Kit Components

KN211629G1, APC gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCGACCGGACCCGAGCCCA

KN211629G2, APC gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGTGGTACAGAAGCGGGCAA

KN211629-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000038, NM_001127510, NM_001127511, NM_001354895, NM_001354896, NM_001354897, NM_001354898, NM_001354899, NM_001354900, NM_001354901, NM_001354902, NM_001354903, NM_001354904, NM_001354905, NM_001354906
Synonyms BTPS2; DP2; DP2.5; DP3; GS; PPP1R46
Summary This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Mutations in the APC gene have been found to occur in most colorectal cancers. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Dec 2019]


Other Versions

Frequently bought together (2)
APC (Myc-DDK-tagged)-Human adenomatous polyposis coli (APC), transcript variant 3
    • 10 ug

USD 2,059.00

APC mouse monoclonal antibody, clone OTI2B8 (formerly 2B8)
    • 100 ul

USD 379.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools