Sodium Potassium ATPase (ATP1A1) Human Gene Knockout Kit (CRISPR)

CAT#: KN201009BN

ATP1A1 - human gene knockout kit via CRISPR, HDR mediated

Product Images

Specifications

Product Data

• Format: 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
• Donor DNA: mBFP-Neo
• Symbol: Sodium Potassium ATPase
• Locus ID: 476
• Components:

  KN201009G1, Sodium Potassium ATPase gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GTGAGTGTCCGGCGCGCCCG

  KN201009G2, Sodium Potassium ATPase gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGAAGTCGGGAGGGCGACCG

  KN201009BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

  GE100003, scramble sequence in pCas-Guide vector

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data

• RefSeq: NM_000701, NM_001001586, NM_001160233, NM_001160234
• UniProt ID: P05023
• Synonyms: MGC3285; MGC51750
• Summary: The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]