Mouse Il4 activation kit by CRISPRa

CAT#: GA202145

Il4 CRISPRa kit - CRISPR gene activation of mouse interleukin 4

Product Images

Specifications

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Symbol: Il4
• Locus ID: 16189
• Kit Components:

  GA202145G1, Il4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCCAGAATAACTGACAATC

  GA202145G2, Il4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGGGAAAATGAGTTTACAT

  GA202145G3, Il4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAGGAGAAAAAAGAGAAAC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.

Reference Data

• RefSeq: NM_021283, NR_027491
• UniProt ID: P07750
• Synonyms: BSF-1; Il-4
• Summary: Participates in at least several B-cell activation processes as well as of other cell types (PubMed:3083412). It is a costimulator of DNA-synthesis. It induces the expression of class II MHC molecules on resting B-cells (PubMed:3498301). It enhances both secretion and cell surface expression of IgE and IgG1 (PubMed:3498301). It also regulates the expression of the low affinity Fc receptor for IgE (CD23) on both lymphocytes and monocytes. Positively regulates IL31RA expression in macrophages (PubMed:25847241). Stimulates autophagy in dendritic cells by interfering with mTORC1 signaling and through the induction of RUFY4 (PubMed:26416964).[UniProtKB/Swiss-Prot Function]