Human PNLIPRP3 activation kit by CRISPRa
CAT#: GA114690
PNLIPRP3 CRISPRa kit - CRISPR gene activation of human pancreatic lipase related protein 3
Find the corresponding CRISPRi Inhibitor Kit
USD 1,657.00
2 Weeks*
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | PNLIPRP3 |
Locus ID | 119548 |
Kit Components | GA114690G1, PNLIPRP3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACTCGGAACATCTTATAGC GA114690G2, PNLIPRP3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAAGTGCCTAATCCTGGTT GA114690G3, PNLIPRP3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGTGCCTTACATCTTATGAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_001011709 |
UniProt ID | Q17RR3 |
Synonyms | OTTHUMP00000020563; pancreatic lipase-related protein 3 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN414033 | PNLIPRP3 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
USD 1,657.00 |
{0} Product Review(s)
Be the first one to submit a review