STK3 (NM_001256313) Human Untagged Clone

CAT#: SC335757

STK3 (untagged) - Human serine/threonine kinase 3 (STK3), transcript variant 3


  "NM_001256313" in other vectors (2)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Anti-STK3 mouse monoclonal antibody, clone OTI4G10 (formerly 4G10)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "STK3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol STK3
Synonyms KRS1; MST2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335757 representing NM_001256313.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGCAGCCGCCGGCGCCTAAGAGTAAACTAAAAAAGCTGAGTGAAGACAGTTTGACTAAGCAGCCT
GAAGAAGTTTTTGATGTATTAGAGAAGCTTGGAGAAGGGTCTTATGGAAGTGTATTTAAAGCAATACAC
AAGGAATCCGGTCAAGTTGTCGCAATTAAACAAGTACCTGTTGAATCAGATCTTCAGGAAATAATCAAA
GAAATTTCCATAATGCAGCAATGTGACAGCCCATATGTTGTAAAGTACTATGGCAGTTATTTTAAGAAT
ACAGACCTCTGGATTGTTATGGAGTACTGTGGCGCTGGCTCTGTCTCAGACATAATTAGATTACGAAAC
AAGACAGCTATTTTTATGATTCCCACAAATCCACCACCAACATTCAGAAAGCCAGAACTTTGGTCCGAT
GATTTCACCGATTTTGTTAAAAAGTGTTTGGTGAAGAATCCTGAGCAGAGAGCTACTGCAACACAACTT
TTACAGCATCCTTTTATCAAGAATGCCAAACCTGTATCAATATTAAGAGACCTGATCACAGAAGCTATG
GAGATCAAAGCTAAAAGACATGAGGAACAGCAACGAGAATTGGAAGAGGAAGAAGAAAATTCGGATGAA
GATGAGCTGGATTCCCACACCATGGTGAAGACTAGTGTGGAGAGTGTGGGCACCATGCGGGCCACAAGC
ACGATGAGTGAAGGGGCCCAGACCATGATTGAACATAATAGCACGATGTTGGAATCCGACTTGGGGACC
ATGGTGATAAACAGTGAGGATGAGGAAGAAGAAGATGGAACTATGAAAAGAAATGCAACCTCACCACAA
GTACAAAGACCATCTTTCATGGACTACTTTGATAAGCAAGACTTCAAGAATAAGAGTCACGAAAACTGT
AATCAGAACATGCATGAACCCTTCCCTATGTCCAAAAACGTTTTTCCTGATAACTGGAAAGTTCCTCAA
GATGGAGACTTTGACTTTTTGAAAAATCTAAGTTTAGAAGAACTACAGATGCGGTTAAAAGCACTGGAC
CCCATGATGGAACGGGAGATAGAAGAACTTCGTCAGAGATACACTGCGAAAAGACAGCCCATTCTGGAT
GCGATGGATGCAAAGAAAAGAAGGCAGCAAAACTTTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001256313
Insert Size 1143 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256313.1
RefSeq Size 2485 bp
RefSeq ORF 1143 bp
Locus ID 6788
Cytogenetics 8q22.2
Protein Families Druggable Genome, Protein Kinase
Protein Pathways MAPK signaling pathway
MW 44 kDa
Gene Summary This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1. The resulting protein (isoform 2) is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.